Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1016837158:

Variant ID: vg1016837158 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16837158
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGAGTTTAAACAGAAATTAATGTTAAGGTCGACACAAATTTCAGCAAAATTTGGATAACAAGAGGGTGGTTGGGCCGGGGCCCGAGGGAGTTGTACT[C/T]
TATAAATGCTTATATTTGTGGATAAATTTTAAATGTTAGAAATAGTTATATTCATGAACAAGAAATGCAGTGAGATAACATGGATTCCTCTCCCGACTGT

Reverse complement sequence

ACAGTCGGGAGAGGAATCCATGTTATCTCACTGCATTTCTTGTTCATGAATATAACTATTTCTAACATTTAAAATTTATCCACAAATATAAGCATTTATA[G/A]
AGTACAACTCCCTCGGGCCCCGGCCCAACCACCCTCTTGTTATCCAAATTTTGCTGAAATTTGTGTCGACCTTAACATTAATTTCTGTTTAAACTCTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele)Frequency of T(secondary allele)Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.60% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 80.00% 20.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 52.60% 47.40% 0.00% 0.00% NA
Japonica Intermediate  241 80.90% 19.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016837158 C -> T LOC_Os10g32040.1 upstream_gene_variant ; 1473.0bp to feature; MODIFIER silent_mutation Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg1016837158 C -> T LOC_Os10g32050.1 upstream_gene_variant ; 276.0bp to feature; MODIFIER silent_mutation Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg1016837158 C -> T LOC_Os10g32060.1 upstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg1016837158 C -> T LOC_Os10g32050-LOC_Os10g32060 intergenic_region ; MODIFIER silent_mutation Average:50.907; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016837158 NA 1.80E-10 mr1156 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 3.24E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 5.59E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 2.49E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 2.42E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 4.74E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 2.43E-06 1.39E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 8.52E-09 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 3.28E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 2.27E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 5.11E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 3.84E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 1.50E-06 2.42E-14 mr1641 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 1.07E-06 mr1641 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 5.54E-10 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 6.14E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 2.27E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 4.94E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 9.80E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 6.56E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016837158 NA 7.09E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251