Variant ID: vg1016576326 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 16576326 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 227. )
CATCTTTGAACGGTGTATTAGTAATATCTCCTTAGAAGGTTTTGCAGGGCTTCCCATGCATGATACATCGCGAAAATTTGGCCTTGGCATTACTTATTTG[A/G]
TGGGGAAATTATGTGCACTATAAGGAGGAATGGAGTATTATTCTAGCTAAACATCTAATTGACCGGAAGGCTATTACTATGTTAATTAGGATATTTGTCA
TGACAAATATCCTAATTAACATAGTAATAGCCTTCCGGTCAATTAGATGTTTAGCTAGAATAATACTCCATTCCTCCTTATAGTGCACATAATTTCCCCA[T/C]
CAAATAAGTAATGCCAAGGCCAAATTTTCGCGATGTATCATGCATGGGAAGCCCTGCAAAACCTTCTAAGGAGATATTACTAATACACCGTTCAAAGATG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 47.50% | 52.50% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 15.40% | 84.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1016576326 | A -> G | LOC_Os10g31630.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.98; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1016576326 | NA | 5.22E-15 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1016576326 | NA | 9.08E-19 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1016576326 | NA | 9.76E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 7.18E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 1.75E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 6.86E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 5.62E-12 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 1.87E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 1.67E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1016576326 | NA | 8.54E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/