RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1016565386:

Variant ID: vg1016565386 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16565386
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.28, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGTCCCTTTTCGATCAATAGATACTCTGAAGGTGTTGATTGCTACATATCACTGTGAGCTACCATTCATGAAGGGCAAAATTTGCTACAGGACACGCA[C/A]
AAATCGTGTAATTAGCTGTAAGACACCAAAAAACGCGTCGCTGCCCACGGACACTACGAAAGTTGTGCAATTGGCTGTAGAACACTGGAGTTAATATTTT

Reverse complement sequence

AAAATATTAACTCCAGTGTTCTACAGCCAATTGCACAACTTTCGTAGTGTCCGTGGGCAGCGACGCGTTTTTTGGTGTCTTACAGCTAATTACACGATTT[G/T]
TGCGTGTCCTGTAGCAAATTTTGCCCTTCATGAATGGTAGCTCACAGTGATATGTAGCAATCAACACCTTCAGAGTATCTATTGATCGAAAAGGGACTCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.10%	0.11%	0.13%	NA
All Indica	2759	90.10%	9.60%	0.11%	0.22%	NA
All Japonica	1512	6.40%	93.50%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	74.30%	25.20%	0.00%	0.50%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	97.60%	2.30%	0.00%	0.11%	NA
Indica Intermediate	786	90.10%	9.30%	0.38%	0.25%	NA
Temperate Japonica	767	2.00%	97.90%	0.13%	0.00%	NA
Tropical Japonica	504	6.30%	93.70%	0.00%	0.00%	NA
Japonica Intermediate	241	20.70%	79.30%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	52.20%	46.70%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016565386	C -> A	LOC_Os10g31600.1	upstream_gene_variant ; 4573.0bp to feature; MODIFIER	silent_mutation	Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1016565386	C -> A	LOC_Os10g31620.1	downstream_gene_variant ; 1813.0bp to feature; MODIFIER	silent_mutation	Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1016565386	C -> A	LOC_Os10g31610.1	intron_variant ; MODIFIER	silent_mutation	Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1016565386	C -> DEL	N	N	silent_mutation	Average:52.056; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016565386	8.29E-06	1.90E-09	mr1071	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	1.42E-06	5.92E-10	mr1080	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	NA	1.48E-07	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	3.02E-06	2.73E-11	mr1140	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	1.79E-06	2.69E-10	mr1203	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	NA	1.64E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	2.22E-06	3.11E-10	mr1395	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	NA	2.12E-09	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	6.48E-07	1.58E-10	mr1618	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016565386	NA	2.72E-08	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 24 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg1016565386:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact