Search for Variation information by Variation ID:
Detailed information for vg1015661029:
| Variant ID: vg1015661029 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15661029 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CCTATGCATCTGCACGGCTTCGCCTTCTATGTCGTGGGACGAGGGTCCGGAACCTTCGACGAGCGCAGGGACCCGGCGACCTACAACCTCGTCGACCCGC[C/T]
GTTCCAGAACACGGTCTCCGTGCCCAAGTCAAGCTGGGCCGCAATCCGCTTCCGCGCAGACAATCCAGGTGAGTTATTCGGATTTCGATCGGATTGTGGT
Reverse complement sequence
ACCACAATCCGATCGAAATCCGAATAACTCACCTGGATTGTCTGCGCGGAAGCGGATTGCGGCCCAGCTTGACTTGGGCACGGAGACCGTGTTCTGGAAC[G/A]
GCGGGTCGACGAGGTTGTAGGTCGCCGGGTCCCTGCGCTCGTCGAAGGTTCCGGACCCTCGTCCCACGACATAGAAGGCGAAGCCGTGCAGATGCATAGG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 2.90% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 8.70% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 74.40% | 24.80% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015661029 | C -> T | LOC_Os10g30140.1 | missense_variant ; p.Pro402Leu; MODERATE | nonsynonymous_codon ; P402L | Average:73.896; most accessible tissue: Callus, score: 93.529 | benign  |
0.617 |
DELETERIOUS | 0.01 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015661029 | NA | 4.46E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015661029 | NA | 4.90E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015661029 | NA | 5.30E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015661029 | NA | 1.61E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015661029 | NA | 6.14E-07 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015661029 | 3.74E-06 | 3.74E-06 | mr1846_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |