RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1015182572:

Variant ID: vg1015182572 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15182572
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAATAAACTCTAAATACTATAAGATTCAATTTTTAAAGATTCTAAGGAGAATGAATAGAAACAGTGAGAAGGATATGACAGAAGTAAGGGGTAATAACT[G/A]
GTGTGACTTTTAAAAACTATAAAATTAGAAGCACGGGGATGATAAGGTTTGGTCTTTCAAAGTTTTAAGATAACGAGATAACTATTTAATAAATTTTAAG

Reverse complement sequence

CTTAAAATTTATTAAATAGTTATCTCGTTATCTTAAAACTTTGAAAGACCAAACCTTATCATCCCCGTGCTTCTAATTTTATAGTTTTTAAAAGTCACAC[C/T]
AGTTATTACCCCTTACTTCTGTCATATCCTTCTCACTGTTTCTATTCATTCTCCTTAGAATCTTTAAAAATTGAATCTTATAGTATTTAGAGTTTATTAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	13.30%	0.34%	1.78%	NA
All Indica	2759	85.50%	14.30%	0.14%	0.07%	NA
All Japonica	1512	98.70%	0.10%	0.13%	1.12%	NA
Aus	269	17.80%	81.80%	0.37%	0.00%	NA
Indica I	595	84.90%	14.50%	0.67%	0.00%	NA
Indica II	465	80.60%	19.40%	0.00%	0.00%	NA
Indica III	913	88.90%	11.00%	0.00%	0.11%	NA
Indica Intermediate	786	84.90%	15.00%	0.00%	0.13%	NA
Temperate Japonica	767	97.90%	0.00%	0.13%	1.96%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	24.00%	3.10%	7.29%	65.62%	NA
Intermediate	90	85.60%	10.00%	2.22%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015182572	G -> A	LOC_Os10g29150.1	downstream_gene_variant ; 80.0bp to feature; MODIFIER	silent_mutation	Average:27.592; most accessible tissue: Callus, score: 55.332	N	N	N	N
vg1015182572	G -> A	LOC_Os10g29159.1	downstream_gene_variant ; 4181.0bp to feature; MODIFIER	silent_mutation	Average:27.592; most accessible tissue: Callus, score: 55.332	N	N	N	N
vg1015182572	G -> A	LOC_Os10g29130-LOC_Os10g29150	intergenic_region ; MODIFIER	silent_mutation	Average:27.592; most accessible tissue: Callus, score: 55.332	N	N	N	N
vg1015182572	G -> DEL	N	N	silent_mutation	Average:27.592; most accessible tissue: Callus, score: 55.332	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015182572	NA	1.05E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	4.24E-07	1.07E-18	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	3.07E-09	5.14E-19	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	NA	6.97E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	NA	1.13E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	NA	2.66E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	NA	9.50E-09	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	1.31E-08	4.36E-56	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	2.53E-07	6.22E-31	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182572	NA	1.49E-15	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 31 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1015182572:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact