Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013060158:

Variant ID: vg1013060158 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13060158
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGTAGGCTGGGCGTTTGCTCGACCATGTCGAGGCTCCGCTTGTCGCATTGTACCAAAAGTTTTGCATTCCCTTGAATAGTGATTGTTCCCTTCGGTCC[C/T]
GGCATCTTGAGCACTTGATACGCGTAGTGAGATACGGCCATGAACTTCGCAAGTGCAGTTCTCCCGATGATGGCGTTAACGCTGTATCGAATTCAGCGAC

Reverse complement sequence

GTCGCTGAATTCGATACAGCGTTAACGCCATCATCGGGAGAACTGCACTTGCGAAGTTCATGGCCGTATCTCACTACGCGTATCAAGTGCTCAAGATGCC[G/A]
GGACCGAAGGGAACAATCACTATTCAAGGGAATGCAAAACTTTTGGTACAATGCGACAAGCGGAGCCTCGACATGGTCGAGCAAACGCCCAGCCTACCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.20% 0.00% 0.30% NA
All Indica  2759 81.50% 18.10% 0.00% 0.47% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 89.20% 10.60% 0.00% 0.17% NA
Indica II  465 92.30% 7.50% 0.00% 0.22% NA
Indica III  913 75.70% 23.70% 0.00% 0.66% NA
Indica Intermediate  786 76.00% 23.40% 0.00% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013060158 C -> T LOC_Os10g25280.1 synonymous_variant ; p.Pro792Pro; LOW synonymous_codon Average:49.14; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg1013060158 C -> DEL LOC_Os10g25280.1 N frameshift_variant Average:49.14; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013060158 8.33E-06 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013060158 4.37E-06 NA mr1051 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251