\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012856484:

Variant ID: vg1012856484 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12856484
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTTTGATCCATAGAAGATAAGAGATCAAGTTTTACACATTTTGGATTCGGATTCGGGCCTCTAGACAGCATCAACTTCAAACGGACCGAGCTGCTAA[T/C]
CTAGAAGGAATTTCGGGGCCTATGAGTACTTGTTGGAAAGCTTATGGAGTCTACTTTCAAATGGTTTTGGACCCACGTCAAAATTTTTATCGAGCTGTCG

Reverse complement sequence

CGACAGCTCGATAAAAATTTTGACGTGGGTCCAAAACCATTTGAAAGTAGACTCCATAAGCTTTCCAACAAGTACTCATAGGCCCCGAAATTCCTTCTAG[A/G]
TTAGCAGCTCGGTCCGTTTGAAGTTGATGCTGTCTAGAGGCCCGAATCCGAATCCAAAATGTGTAAAACTTGATCTCTTATCTTCTATGGATCAAAAGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.30% 0.11% 0.42% NA
All Indica  2759 68.50% 30.60% 0.14% 0.72% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 82.20% 17.30% 0.00% 0.50% NA
Indica II  465 63.00% 35.50% 0.00% 1.51% NA
Indica III  913 70.20% 28.90% 0.33% 0.55% NA
Indica Intermediate  786 59.40% 39.80% 0.13% 0.64% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012856484 T -> C LOC_Os10g24970.1 upstream_gene_variant ; 700.0bp to feature; MODIFIER silent_mutation Average:41.324; most accessible tissue: Callus, score: 63.079 N N N N
vg1012856484 T -> C LOC_Os10g24980.1 upstream_gene_variant ; 1921.0bp to feature; MODIFIER silent_mutation Average:41.324; most accessible tissue: Callus, score: 63.079 N N N N
vg1012856484 T -> C LOC_Os10g24954.1 downstream_gene_variant ; 2605.0bp to feature; MODIFIER silent_mutation Average:41.324; most accessible tissue: Callus, score: 63.079 N N N N
vg1012856484 T -> C LOC_Os10g24970-LOC_Os10g24980 intergenic_region ; MODIFIER silent_mutation Average:41.324; most accessible tissue: Callus, score: 63.079 N N N N
vg1012856484 T -> DEL N N silent_mutation Average:41.324; most accessible tissue: Callus, score: 63.079 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012856484 NA 3.48E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 2.07E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.31E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 9.11E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 2.07E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 3.07E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.07E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 2.45E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.61E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.22E-09 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.08E-10 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 5.39E-08 mr1567_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.97E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 1.65E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012856484 NA 2.67E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251