Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012245318:

Variant ID: vg1012245318 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12245318
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCAGGAGTCGAATTAATGATCATAGTAATATCATTAATGAGTAGTTTGAGACTAATCACGAAAAATATTGTTAGACCCGCCCATAACCGCGGGCACG[A/G]
CTATTCGAATAGTTTTACTCTAGCCAGAGATATACCACTGTACCCAAAAGACACAGCTCCACGACATGTCACCATGCACCTCAATACCACCACGGTACCT

Reverse complement sequence

AGGTACCGTGGTGGTATTGAGGTGCATGGTGACATGTCGTGGAGCTGTGTCTTTTGGGTACAGTGGTATATCTCTGGCTAGAGTAAAACTATTCGAATAG[T/C]
CGTGCCCGCGGTTATGGGCGGGTCTAACAATATTTTTCGTGATTAGTCTCAAACTACTCATTAATGATATTACTATGATCATTAATTCGACTCCTGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	18.00%	1.67%	47.80%	NA
All Indica	2759	4.90%	28.90%	2.57%	63.65%	NA
All Japonica	1512	89.40%	0.40%	0.07%	10.12%	NA
Aus	269	2.20%	9.30%	1.49%	86.99%	NA
Indica I	595	8.60%	7.20%	4.03%	80.17%	NA
Indica II	465	6.00%	36.30%	2.37%	55.27%	NA
Indica III	913	1.50%	34.30%	1.53%	62.65%	NA
Indica Intermediate	786	5.20%	34.70%	2.80%	57.25%	NA
Temperate Japonica	767	97.10%	0.30%	0.00%	2.61%	NA
Tropical Japonica	504	82.10%	0.40%	0.20%	17.26%	NA
Japonica Intermediate	241	80.10%	0.80%	0.00%	19.09%	NA
VI/Aromatic	96	8.30%	4.20%	0.00%	87.50%	NA
Intermediate	90	43.30%	17.80%	3.33%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012245318	A -> G	LOC_Os10g23870.1	upstream_gene_variant ; 3896.0bp to feature; MODIFIER	silent_mutation	Average:9.969; most accessible tissue: Callus, score: 38.926	N	N	N	N
vg1012245318	A -> G	LOC_Os10g23880.1	downstream_gene_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:9.969; most accessible tissue: Callus, score: 38.926	N	N	N	N
vg1012245318	A -> G	LOC_Os10g23870-LOC_Os10g23880	intergenic_region ; MODIFIER	silent_mutation	Average:9.969; most accessible tissue: Callus, score: 38.926	N	N	N	N
vg1012245318	A -> DEL	N	N	silent_mutation	Average:9.969; most accessible tissue: Callus, score: 38.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012245318	NA	5.07E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	NA	1.33E-06	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	2.86E-06	2.26E-10	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	5.15E-06	1.52E-08	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	NA	3.20E-10	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	4.71E-06	3.11E-08	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	2.35E-08	3.83E-15	mr1446_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012245318	1.89E-06	8.35E-10	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251