\
| Variant ID: vg1011512046 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 11512046 |
| Reference Allele: TCTCGCAAGGAACTCAACC | Alternative Allele: ACTCGCAAGGAACTCAACC,CCTCGCAAGGAACTCAACC,T |
| Primary Allele: TCTCGCAAGGAACTCAACC | Secondary Allele: CCTCGCAAGGAACTCAACC |
Inferred Ancestral Allele: Not determined.
AGAGCAATACGCCAAGAAGGCACGGAAGCCGACTGATGGAGAACAAAGCACTTCAAAAAAGAAGGATGATGACTATGACGGATCGACTGGTTTTCAAGAC[TCTCGCAAGGAACTCAACC/ACTCGCAAGGAACTCAACC,CCTCGCAAGGAACTCAACC,T]
ATATTTTCGGTGGACCCGAAGCTTACGAGTCCAAGCGGAAGCAAAAGTTGACTGAAAGGGAGATTAACGCCGTCCAGCCCGATACACCCCAATATCTTCG
CGAAGATATTGGGGTGTATCGGGCTGGACGGCGTTAATCTCCCTTTCAGTCAACTTTTGCTTCCGCTTGGACTCGTAAGCTTCGGGTCCACCGAAAATAT[GGTTGAGTTCCTTGCGAGA/GGTTGAGTTCCTTGCGAGT,GGTTGAGTTCCTTGCGAGG,A]
GTCTTGAAAACCAGTCGATCCGTCATAGTCATCATCCTTCTTTTTTGAAGTGCTTTGTTCTCCATCAGTCGGCTTCCGTGCCTTCTTGGCGTATTGCTCT
| Populations | Population Size | Frequency of TCTCGCAAGGAACTCAACC(primary allele) | Frequency of CCTCGCAAGGAACTCAACC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 8.10% | 2.16% | 17.58% | ACTCGCAAGGAACTCAACC: 4.46%; T: 0.02% |
| All Indica | 2759 | 72.10% | 6.70% | 2.25% | 15.48% | ACTCGCAAGGAACTCAACC: 3.52% |
| All Japonica | 1512 | 66.70% | 12.80% | 1.39% | 14.88% | ACTCGCAAGGAACTCAACC: 4.23%; T: 0.07% |
| Aus | 269 | 20.80% | 0.70% | 5.95% | 58.36% | ACTCGCAAGGAACTCAACC: 14.13% |
| Indica I | 595 | 86.60% | 6.10% | 1.34% | 6.05% | NA |
| Indica II | 465 | 89.70% | 1.50% | 2.37% | 6.24% | ACTCGCAAGGAACTCAACC: 0.22% |
| Indica III | 913 | 53.80% | 9.40% | 1.97% | 27.71% | ACTCGCAAGGAACTCAACC: 7.12% |
| Indica Intermediate | 786 | 71.90% | 7.10% | 3.18% | 13.87% | ACTCGCAAGGAACTCAACC: 3.94% |
| Temperate Japonica | 767 | 88.30% | 0.40% | 0.65% | 8.87% | ACTCGCAAGGAACTCAACC: 1.69%; T: 0.13% |
| Tropical Japonica | 504 | 45.00% | 34.10% | 1.59% | 11.11% | ACTCGCAAGGAACTCAACC: 8.13% |
| Japonica Intermediate | 241 | 43.20% | 7.50% | 3.32% | 41.91% | ACTCGCAAGGAACTCAACC: 4.15% |
| VI/Aromatic | 96 | 83.30% | 1.00% | 2.08% | 6.25% | ACTCGCAAGGAACTCAACC: 7.29% |
| Intermediate | 90 | 72.20% | 3.30% | 1.11% | 17.78% | ACTCGCAAGGAACTCAACC: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011512046 | TCTCGCAAGGAACTCAACC -> DEL | LOC_Os10g22240.1 | N | frameshift_variant | Average:28.379; most accessible tissue: Callus, score: 42.027 | N | N | N | N |
| vg1011512046 | TCTCGCAAGGAACTCAACC -> ACTCGCAAGGAACTCAACC | LOC_Os10g22240.1 | missense_variant ; p.Ser548Thr; MODERATE | nonsynonymous_codon ; S548T | Average:28.379; most accessible tissue: Callus, score: 42.027 | benign |
+1.235 |
N | N |
| vg1011512046 | TCTCGCAAGGAACTCAACC -> T | LOC_Os10g22240.1 | disruptive_inframe_deletion ; p.Ser548_His554delinsTyr; MODERATE | inframe_variant | Average:28.379; most accessible tissue: Callus, score: 42.027 | N | N | N | N |
| vg1011512046 | TCTCGCAAGGAACTCAACC -> CCTCGCAAGGAACTCAACC | LOC_Os10g22240.1 | missense_variant ; p.Ser548Pro; MODERATE | nonsynonymous_codon ; S548P | Average:28.379; most accessible tissue: Callus, score: 42.027 | benign |
+0.288 |
N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011512046 | 4.27E-09 | 1.76E-12 | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 9.05E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 3.81E-08 | 5.23E-11 | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 6.34E-06 | NA | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 5.16E-08 | 2.46E-11 | mr1019 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 7.80E-07 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 3.88E-09 | 4.52E-12 | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | NA | 6.01E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 5.31E-06 | 5.31E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 3.62E-07 | 2.14E-10 | mr1132 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | NA | 5.92E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 4.01E-07 | NA | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | NA | 3.06E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 2.95E-07 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | NA | 4.97E-06 | mr1557 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | NA | 8.58E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | NA | 6.49E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 4.39E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 5.04E-07 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 9.04E-08 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 1.93E-08 | NA | mr1390_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512046 | 1.79E-08 | NA | mr1490_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |