\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009343932:

Variant ID: vg1009343932 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9343932
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCATCTCCCGAGAAAGCTAGCTAAACAATTATATCTCGAATAATATCTCATAAAGTAGGTACTCAAATAGTCAGAGTGAAGTAAAGTATCGTAAATATA[T/C]
TGAGAAGAATATTCTATAAATATTGCAAGTCTTACAAAAGAAGGAAAAGCTGCTAGAGCCATACCCGAACTCTTCTGAAGACTCCGAGAACTGAAGATTC

Reverse complement sequence

GAATCTTCAGTTCTCGGAGTCTTCAGAAGAGTTCGGGTATGGCTCTAGCAGCTTTTCCTTCTTTTGTAAGACTTGCAATATTTATAGAATATTCTTCTCA[A/G]
TATATTTACGATACTTTACTTCACTCTGACTATTTGAGTACCTACTTTATGAGATATTATTCGAGATATAATTGTTTAGCTAGCTTTCTCGGGAGATGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 0.80% 0.28% 1.86% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.10% 2.40% 0.79% 5.69% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 89.40% 3.40% 1.30% 5.87% NA
Tropical Japonica  504 98.80% 0.20% 0.00% 0.99% NA
Japonica Intermediate  241 80.10% 4.10% 0.83% 14.94% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 0.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009343932 T -> C LOC_Os10g18380.1 upstream_gene_variant ; 621.0bp to feature; MODIFIER silent_mutation Average:38.72; most accessible tissue: Callus, score: 62.037 N N N N
vg1009343932 T -> C LOC_Os10g18390.1 upstream_gene_variant ; 1543.0bp to feature; MODIFIER silent_mutation Average:38.72; most accessible tissue: Callus, score: 62.037 N N N N
vg1009343932 T -> C LOC_Os10g18370.1 downstream_gene_variant ; 4712.0bp to feature; MODIFIER silent_mutation Average:38.72; most accessible tissue: Callus, score: 62.037 N N N N
vg1009343932 T -> C LOC_Os10g18380-LOC_Os10g18390 intergenic_region ; MODIFIER silent_mutation Average:38.72; most accessible tissue: Callus, score: 62.037 N N N N
vg1009343932 T -> DEL N N silent_mutation Average:38.72; most accessible tissue: Callus, score: 62.037 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009343932 NA 1.10E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 1.54E-06 3.80E-07 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 8.32E-06 1.94E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 NA 3.97E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 NA 3.51E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 NA 1.87E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 7.86E-06 7.86E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 NA 2.67E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 4.65E-07 6.34E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 2.09E-06 2.09E-06 mr1704 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 2.79E-07 3.23E-08 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 NA 3.38E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009343932 NA 6.35E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251