\
| Variant ID: vg1009343932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9343932 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCCATCTCCCGAGAAAGCTAGCTAAACAATTATATCTCGAATAATATCTCATAAAGTAGGTACTCAAATAGTCAGAGTGAAGTAAAGTATCGTAAATATA[T/C]
TGAGAAGAATATTCTATAAATATTGCAAGTCTTACAAAAGAAGGAAAAGCTGCTAGAGCCATACCCGAACTCTTCTGAAGACTCCGAGAACTGAAGATTC
GAATCTTCAGTTCTCGGAGTCTTCAGAAGAGTTCGGGTATGGCTCTAGCAGCTTTTCCTTCTTTTGTAAGACTTGCAATATTTATAGAATATTCTTCTCA[A/G]
TATATTTACGATACTTTACTTCACTCTGACTATTTGAGTACCTACTTTATGAGATATTATTCGAGATATAATTGTTTAGCTAGCTTTCTCGGGAGATGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 0.80% | 0.28% | 1.86% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 2.40% | 0.79% | 5.69% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.40% | 3.40% | 1.30% | 5.87% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 80.10% | 4.10% | 0.83% | 14.94% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009343932 | T -> C | LOC_Os10g18380.1 | upstream_gene_variant ; 621.0bp to feature; MODIFIER | silent_mutation | Average:38.72; most accessible tissue: Callus, score: 62.037 | N | N | N | N |
| vg1009343932 | T -> C | LOC_Os10g18390.1 | upstream_gene_variant ; 1543.0bp to feature; MODIFIER | silent_mutation | Average:38.72; most accessible tissue: Callus, score: 62.037 | N | N | N | N |
| vg1009343932 | T -> C | LOC_Os10g18370.1 | downstream_gene_variant ; 4712.0bp to feature; MODIFIER | silent_mutation | Average:38.72; most accessible tissue: Callus, score: 62.037 | N | N | N | N |
| vg1009343932 | T -> C | LOC_Os10g18380-LOC_Os10g18390 | intergenic_region ; MODIFIER | silent_mutation | Average:38.72; most accessible tissue: Callus, score: 62.037 | N | N | N | N |
| vg1009343932 | T -> DEL | N | N | silent_mutation | Average:38.72; most accessible tissue: Callus, score: 62.037 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009343932 | NA | 1.10E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | 1.54E-06 | 3.80E-07 | mr1013 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | 8.32E-06 | 1.94E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | NA | 3.97E-06 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | NA | 3.51E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | NA | 1.87E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | 7.86E-06 | 7.86E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | NA | 2.67E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | 4.65E-07 | 6.34E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | 2.09E-06 | 2.09E-06 | mr1704 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | 2.79E-07 | 3.23E-08 | mr1765 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | NA | 3.38E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009343932 | NA | 6.35E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |