\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009320430:

Variant ID: vg1009320430 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9320430
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GACTCCGATGCCGACGACGAGGACGATGCCGAAGAACGCGACGGCGAGGGGGAAGCAGAGGAGGAGGAGGAGGCCGTGGCCGATAAGGCCGCGAACGAGG[C/T]
GGTCGGAGACCGCGTCGACACCCTCGGCTACACTCCTACCCCAAGTCCAGGTCCCAACGAGACCGGGGTGGAGTCGAACAGCTCCCCCCTTCGACGGAAG

Reverse complement sequence

CTTCCGTCGAAGGGGGGAGCTGTTCGACTCCACCCCGGTCTCGTTGGGACCTGGACTTGGGGTAGGAGTGTAGCCGAGGGTGTCGACGCGGTCTCCGACC[G/A]
CCTCGTTCGCGGCCTTATCGGCCACGGCCTCCTCCTCCTCCTCTGCTTCCCCCTCGCCGTCGCGTTCTTCGGCATCGTCCTCGTCGTCGGCATCGGAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 24.30% 0.76% 0.02% NA
All Indica  2759 60.50% 38.80% 0.69% 0.04% NA
All Japonica  1512 96.40% 3.40% 0.20% 0.00% NA
Aus  269 93.30% 1.90% 4.83% 0.00% NA
Indica I  595 73.80% 25.40% 0.84% 0.00% NA
Indica II  465 40.60% 58.50% 0.86% 0.00% NA
Indica III  913 64.80% 34.80% 0.33% 0.00% NA
Indica Intermediate  786 57.00% 42.00% 0.89% 0.13% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.30% 0.60% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009320430 C -> T LOC_Os10g18350.1 missense_variant ; p.Ala378Val; MODERATE nonsynonymous_codon ; A378V Average:54.139; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 possibly damaging 1.639 TOLERATED 0.08
vg1009320430 C -> DEL LOC_Os10g18350.1 N frameshift_variant Average:54.139; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009320430 NA 3.92E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 7.25E-06 3.75E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 5.09E-06 3.70E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 1.51E-12 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 1.03E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 5.56E-10 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 1.21E-07 2.16E-10 mr1053_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 4.15E-08 1.22E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 4.21E-07 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 1.75E-07 6.26E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 8.47E-07 4.01E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 1.20E-06 1.22E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 2.79E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 3.86E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 1.85E-11 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009320430 NA 2.42E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251