Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008202012:

Variant ID: vg1008202012 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8202012
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGGGGGATTTGAGCCTTAGAAAAGGTGGGGGAGGTAGGATTGGCCCAAGGGAGAGGGGGGTAGAATAGTTATTGGGGAGGGGTGTATATAATCATTTT[C/T]
CTAGGACGGCCATTCTATACACCTAGATGTATGTACACCCTCTTCTTATTGGATACTAAATAATTGGATTAAAAAGAAAATTTAAAGGAAATACCGTTCC

Reverse complement sequence

GGAACGGTATTTCCTTTAAATTTTCTTTTTAATCCAATTATTTAGTATCCAATAAGAAGAGGGTGTACATACATCTAGGTGTATAGAATGGCCGTCCTAG[G/A]
AAAATGATTATATACACCCCTCCCCAATAACTATTCTACCCCCCTCTCCCTTGGGCCAATCCTACCTCCCCCACCTTTTCTAAGGCTCAAATCCCCCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 21.30% 0.47% 3.36% NA
All Indica  2759 64.40% 35.10% 0.36% 0.07% NA
All Japonica  1512 88.70% 0.70% 0.53% 10.12% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 90.30% 9.60% 0.17% 0.00% NA
Indica II  465 41.10% 58.70% 0.22% 0.00% NA
Indica III  913 64.20% 35.60% 0.22% 0.00% NA
Indica Intermediate  786 59.00% 39.90% 0.76% 0.25% NA
Temperate Japonica  767 79.10% 0.40% 0.78% 19.69% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 1.70% 0.83% 0.83% NA
VI/Aromatic  96 89.60% 8.30% 2.08% 0.00% NA
Intermediate  90 75.60% 17.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008202012 C -> T LOC_Os10g16450.1 upstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:87.038; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1008202012 C -> T LOC_Os10g16440.1 downstream_gene_variant ; 940.0bp to feature; MODIFIER silent_mutation Average:87.038; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1008202012 C -> T LOC_Os10g16440.2 downstream_gene_variant ; 940.0bp to feature; MODIFIER silent_mutation Average:87.038; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1008202012 C -> T LOC_Os10g16440-LOC_Os10g16450 intergenic_region ; MODIFIER silent_mutation Average:87.038; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N
vg1008202012 C -> DEL N N silent_mutation Average:87.038; most accessible tissue: Zhenshan97 panicle, score: 93.133 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1008202012 C T -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008202012 8.41E-06 8.41E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 NA 7.66E-15 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 NA 3.83E-12 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 3.68E-06 NA mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 1.75E-06 2.65E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 NA 2.89E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 NA 1.14E-12 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 NA 5.09E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008202012 NA 3.86E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251