\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006612280:

Variant ID: vg1006612280 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6612280
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.07, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CAATACTTTTGACAAGATCATGAACTCCCAATGTCCGCATCATCCAAATTCCAATCATGCGGCCAAAGATTGCTTCGTCTACAAACAGTTTGCAGAACAA[A/T]
ACACCAAGAATGCACGAAAGGCCTCCGACGGAGATCAAAGCATGTCAAAAAAGAAGGACGATGACGACGATGCCCCGATAGGTTTTCGAGACCGTCGTAA

Reverse complement sequence

TTACGACGGTCTCGAAAACCTATCGGGGCATCGTCGTCATCGTCCTTCTTTTTTGACATGCTTTGATCTCCGTCGGAGGCCTTTCGTGCATTCTTGGTGT[T/A]
TTGTTCTGCAAACTGTTTGTAGACGAAGCAATCTTTGGCCGCATGATTGGAATTTGGATGATGCGGACATTGGGAGTTCATGATCTTGTCAAAAGTATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.20% 19.60% 1.33% 56.83% NA
All Indica  2759 36.50% 1.60% 1.74% 60.17% NA
All Japonica  1512 0.90% 56.70% 0.20% 42.20% NA
Aus  269 2.20% 0.40% 4.09% 93.31% NA
Indica I  595 10.10% 2.00% 4.37% 83.53% NA
Indica II  465 60.60% 1.10% 0.43% 37.85% NA
Indica III  913 36.80% 1.20% 0.55% 61.45% NA
Indica Intermediate  786 41.90% 2.00% 1.91% 54.20% NA
Temperate Japonica  767 0.40% 88.90% 0.00% 10.69% NA
Tropical Japonica  504 0.40% 8.70% 0.40% 90.48% NA
Japonica Intermediate  241 3.30% 54.80% 0.41% 41.49% NA
VI/Aromatic  96 3.10% 5.20% 1.04% 90.62% NA
Intermediate  90 24.40% 20.00% 0.00% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006612280 A -> T LOC_Os10g11920.1 missense_variant ; p.Asn28Tyr; MODERATE nonsynonymous_codon Average:9.839; most accessible tissue: Callus, score: 25.028 probably damaging -2.157 TOLERATED 1.00
vg1006612280 A -> DEL LOC_Os10g11920.1 N frameshift_variant Average:9.839; most accessible tissue: Callus, score: 25.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006612280 7.48E-06 NA mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 3.40E-06 2.03E-06 mr1345 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 3.66E-06 3.14E-06 mr1401 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 2.84E-07 2.84E-07 mr1417 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 5.81E-06 NA mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 4.10E-06 NA mr1611 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 1.86E-06 1.86E-06 mr1635 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 9.30E-06 NA mr1816 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 1.77E-06 1.77E-06 mr1823 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 1.26E-06 NA mr1844 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006612280 5.39E-06 5.39E-06 mr1881 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251