\
| Variant ID: vg1006612280 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6612280 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.07, others allele: 0.00, population size: 86. )
CAATACTTTTGACAAGATCATGAACTCCCAATGTCCGCATCATCCAAATTCCAATCATGCGGCCAAAGATTGCTTCGTCTACAAACAGTTTGCAGAACAA[A/T]
ACACCAAGAATGCACGAAAGGCCTCCGACGGAGATCAAAGCATGTCAAAAAAGAAGGACGATGACGACGATGCCCCGATAGGTTTTCGAGACCGTCGTAA
TTACGACGGTCTCGAAAACCTATCGGGGCATCGTCGTCATCGTCCTTCTTTTTTGACATGCTTTGATCTCCGTCGGAGGCCTTTCGTGCATTCTTGGTGT[T/A]
TTGTTCTGCAAACTGTTTGTAGACGAAGCAATCTTTGGCCGCATGATTGGAATTTGGATGATGCGGACATTGGGAGTTCATGATCTTGTCAAAAGTATTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.20% | 19.60% | 1.33% | 56.83% | NA |
| All Indica | 2759 | 36.50% | 1.60% | 1.74% | 60.17% | NA |
| All Japonica | 1512 | 0.90% | 56.70% | 0.20% | 42.20% | NA |
| Aus | 269 | 2.20% | 0.40% | 4.09% | 93.31% | NA |
| Indica I | 595 | 10.10% | 2.00% | 4.37% | 83.53% | NA |
| Indica II | 465 | 60.60% | 1.10% | 0.43% | 37.85% | NA |
| Indica III | 913 | 36.80% | 1.20% | 0.55% | 61.45% | NA |
| Indica Intermediate | 786 | 41.90% | 2.00% | 1.91% | 54.20% | NA |
| Temperate Japonica | 767 | 0.40% | 88.90% | 0.00% | 10.69% | NA |
| Tropical Japonica | 504 | 0.40% | 8.70% | 0.40% | 90.48% | NA |
| Japonica Intermediate | 241 | 3.30% | 54.80% | 0.41% | 41.49% | NA |
| VI/Aromatic | 96 | 3.10% | 5.20% | 1.04% | 90.62% | NA |
| Intermediate | 90 | 24.40% | 20.00% | 0.00% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006612280 | A -> T | LOC_Os10g11920.1 | missense_variant ; p.Asn28Tyr; MODERATE | nonsynonymous_codon | Average:9.839; most accessible tissue: Callus, score: 25.028 | probably damaging |
-2.157 |
TOLERATED | 1.00 |
| vg1006612280 | A -> DEL | LOC_Os10g11920.1 | N | frameshift_variant | Average:9.839; most accessible tissue: Callus, score: 25.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006612280 | 7.48E-06 | NA | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 3.40E-06 | 2.03E-06 | mr1345 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 3.66E-06 | 3.14E-06 | mr1401 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 2.84E-07 | 2.84E-07 | mr1417 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 5.81E-06 | NA | mr1515 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 4.10E-06 | NA | mr1611 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 1.86E-06 | 1.86E-06 | mr1635 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 9.30E-06 | NA | mr1816 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 1.77E-06 | 1.77E-06 | mr1823 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 1.26E-06 | NA | mr1844 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006612280 | 5.39E-06 | 5.39E-06 | mr1881 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |