Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006587700:

Variant ID: vg1006587700 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6587700
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATGTACCGGACCAGCTATTCTTGCTTGAGCAGGTAGATGGACCATCAAGTGTATCATAATAGTAAAAAATGAGGGTAGGAATATTTTCTCAAGAAGA[C/A]
ATATGGTCTCAGCTATTTCTGCCTCTAGTTTTTGCATATCACTTACACGGATAACAGGCGAATATATTTGCTTAAAAAAATTGCTCACACGAATCAGTGC

Reverse complement sequence

GCACTGATTCGTGTGAGCAATTTTTTTAAGCAAATATATTCGCCTGTTATCCGTGTAAGTGATATGCAAAAACTAGAGGCAGAAATAGCTGAGACCATAT[G/T]
TCTTCTTGAGAAAATATTCCTACCCTCATTTTTTACTATTATGATACACTTGATGGTCCATCTACCTGCTCAAGCAAGAATAGCTGGTCCGGTACATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	2.60%	2.62%	15.11%	NA
All Indica	2759	78.40%	0.20%	3.84%	17.58%	NA
All Japonica	1512	76.90%	7.90%	0.73%	14.48%	NA
Aus	269	97.40%	0.00%	2.23%	0.37%	NA
Indica I	595	86.20%	0.00%	2.86%	10.92%	NA
Indica II	465	86.00%	0.20%	3.44%	10.32%	NA
Indica III	913	69.40%	0.20%	4.27%	26.07%	NA
Indica Intermediate	786	78.40%	0.30%	4.33%	17.05%	NA
Temperate Japonica	767	84.70%	0.30%	0.52%	14.47%	NA
Tropical Japonica	504	65.30%	21.40%	0.79%	12.50%	NA
Japonica Intermediate	241	75.90%	4.10%	1.24%	18.67%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	90.00%	0.00%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006587700	C -> A	LOC_Os10g11870.1	missense_variant ; p.Cys712Phe; MODERATE	nonsynonymous_codon ; C712F	Average:14.468; most accessible tissue: Zhenshan97 panicle, score: 28.447	probably damaging	2.392	DELETERIOUS	0.00
vg1006587700	C -> DEL	LOC_Os10g11870.1	N	frameshift_variant	Average:14.468; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006587700	1.91E-09	5.39E-14	mr1016	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	1.24E-09	1.11E-13	mr1017	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	2.23E-07	5.54E-11	mr1018	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	3.29E-08	1.32E-12	mr1019	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	4.78E-09	7.86E-14	mr1055	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	9.76E-09	4.05E-13	mr1132	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	3.77E-06	1.60E-10	mr1178	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	NA	5.77E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	1.87E-07	2.19E-11	mr1390	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	NA	1.35E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	7.22E-07	3.77E-11	mr1490	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	1.78E-07	NA	mr1023_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	1.21E-10	1.18E-13	mr1055_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	5.14E-06	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	9.98E-13	1.86E-15	mr1132_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	6.31E-07	NA	mr1178_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	4.64E-06	7.10E-09	mr1261_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	1.89E-10	1.27E-13	mr1390_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	3.12E-07	NA	mr1489_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006587700	5.74E-12	1.21E-14	mr1490_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251