\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006547989:

Variant ID: vg1006547989 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6547989
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAGCCTTTGAGGCTGTGTTAGCATGCACCTTTTCCCATCCCCTCTCCCTCGTTTTCCGCGTGCACGCTTTTCAAACTGCTAAACGGTGCGTTTTTTT[A/T]
AAAAAAGTTTCTATACGAAAGTTGCTTAAAAAAATCAAATTAATCCATTTTTGAAAAAAAAAATAGCTAATACTTAATTAATCACGCGTTAATGGACTGC

Reverse complement sequence

GCAGTCCATTAACGCGTGATTAATTAAGTATTAGCTATTTTTTTTTTCAAAAATGGATTAATTTGATTTTTTTAAGCAACTTTCGTATAGAAACTTTTTT[T/A]
AAAAAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCACGCGGAAAACGAGGGAGAGGGGATGGGAAAAGGTGCATGCTAACACAGCCTCAAAGGCTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 43.80% 0.53% 0.47% NA
All Indica  2759 40.70% 58.70% 0.51% 0.11% NA
All Japonica  1512 73.70% 25.50% 0.73% 0.07% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 13.40% 85.40% 1.18% 0.00% NA
Indica II  465 61.30% 38.30% 0.43% 0.00% NA
Indica III  913 41.40% 58.30% 0.11% 0.22% NA
Indica Intermediate  786 48.30% 51.00% 0.51% 0.13% NA
Temperate Japonica  767 78.60% 20.20% 1.17% 0.00% NA
Tropical Japonica  504 71.00% 28.60% 0.40% 0.00% NA
Japonica Intermediate  241 63.50% 36.10% 0.00% 0.41% NA
VI/Aromatic  96 49.00% 32.30% 0.00% 18.75% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006547989 A -> T LOC_Os10g11810.1 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:77.457; most accessible tissue: Minghui63 root, score: 89.689 N N N N
vg1006547989 A -> T LOC_Os10g11820.1 downstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:77.457; most accessible tissue: Minghui63 root, score: 89.689 N N N N
vg1006547989 A -> T LOC_Os10g11810.2 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:77.457; most accessible tissue: Minghui63 root, score: 89.689 N N N N
vg1006547989 A -> T LOC_Os10g11810.3 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:77.457; most accessible tissue: Minghui63 root, score: 89.689 N N N N
vg1006547989 A -> T LOC_Os10g11810-LOC_Os10g11820 intergenic_region ; MODIFIER silent_mutation Average:77.457; most accessible tissue: Minghui63 root, score: 89.689 N N N N
vg1006547989 A -> DEL N N silent_mutation Average:77.457; most accessible tissue: Minghui63 root, score: 89.689 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006547989 A T -0.01 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006547989 4.70E-06 NA mr1147 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 6.72E-06 NA mr1371 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 7.91E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 2.61E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 2.75E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 3.52E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 1.47E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 4.09E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 1.43E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006547989 NA 4.14E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251