\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005364864:

Variant ID: vg1005364864 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5364864
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AACGAACTCGCCCACACTCGCAACATCAACAACATTCAAATCGCCAAAGGTTTGAGAATGGATTCACTTATCCGGCGACGAGTTCATGCCAAGTACACTC[C/G]
ATATTCGCCACCCTCACCACCCCGGGATGCAGTGCGACGGCGGCGCCTACATGCGGTGTGTCGACGGTGAGCTCCTTCCGCGACGAGCCGTCTTCATGAC

Reverse complement sequence

GTCATGAAGACGGCTCGTCGCGGAAGGAGCTCACCGTCGACACACCGCATGTAGGCGCCGCCGTCGCACTGCATCCCGGGGTGGTGAGGGTGGCGAATAT[G/C]
GAGTGTACTTGGCATGAACTCGTCGCCGGATAAGTGAATCCATTCTCAAACCTTTGGCGATTTGAATGTTGTTGATGTTGCGAGTGTGGGCGAGTTCGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 19.40% 4.38% 23.55% NA
All Indica  2759 54.00% 28.10% 4.10% 13.81% NA
All Japonica  1512 55.30% 2.10% 3.44% 39.15% NA
Aus  269 9.30% 34.90% 10.41% 45.35% NA
Indica I  595 50.90% 33.40% 3.19% 12.44% NA
Indica II  465 58.30% 12.70% 6.24% 22.80% NA
Indica III  913 50.10% 34.20% 2.96% 12.81% NA
Indica Intermediate  786 58.30% 26.20% 4.83% 10.69% NA
Temperate Japonica  767 69.10% 0.40% 3.65% 26.86% NA
Tropical Japonica  504 35.70% 4.80% 2.18% 57.34% NA
Japonica Intermediate  241 52.30% 2.10% 5.39% 40.25% NA
VI/Aromatic  96 87.50% 1.00% 6.25% 5.21% NA
Intermediate  90 63.30% 13.30% 8.89% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005364864 C -> G LOC_Os10g09910.1 upstream_gene_variant ; 557.0bp to feature; MODIFIER silent_mutation Average:29.194; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg1005364864 C -> G LOC_Os10g09920.1 upstream_gene_variant ; 4367.0bp to feature; MODIFIER silent_mutation Average:29.194; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg1005364864 C -> G LOC_Os10g09890.1 downstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:29.194; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg1005364864 C -> G LOC_Os10g09900.1 intron_variant ; MODIFIER silent_mutation Average:29.194; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg1005364864 C -> DEL N N silent_mutation Average:29.194; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005364864 7.85E-07 1.14E-07 mr1089 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 4.00E-09 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.36E-10 4.67E-13 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.03E-08 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.46E-09 2.08E-12 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 6.80E-06 6.92E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 NA 1.26E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 6.89E-06 8.93E-09 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 4.05E-06 1.48E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.92E-06 NA mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 4.83E-07 1.99E-12 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 7.74E-06 NA mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.76E-06 1.78E-07 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.09E-10 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.92E-10 2.17E-13 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.71E-09 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 8.52E-09 4.16E-14 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.84E-06 2.84E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 6.50E-07 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.77E-09 1.43E-12 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 3.52E-08 NA mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.08E-08 1.04E-13 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 NA 8.45E-08 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 7.06E-07 NA mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.68E-07 3.29E-10 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 6.21E-06 NA mr1102_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 7.17E-08 NA mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 4.35E-09 1.65E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.66E-06 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 4.78E-07 4.51E-12 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 NA 1.51E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.13E-06 6.02E-10 mr1236_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.47E-06 1.15E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 6.00E-08 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.68E-07 3.82E-12 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 3.95E-06 NA mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 4.68E-06 8.80E-12 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 NA 9.03E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 3.44E-06 1.56E-08 mr1379_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 NA 2.97E-07 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 2.01E-06 9.39E-10 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 3.93E-06 3.99E-09 mr1559_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 6.34E-06 2.71E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 NA 3.12E-06 mr1880_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364864 1.90E-06 NA mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251