\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005364284:

Variant ID: vg1005364284 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5364284
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCGTTGTTAATAGCAAACTGTCTCATTGCCAATCTAAACTCCTCCATGCTGGGGTATGCAGTTCCAAGATCCATGCAAGGGTTGTCAGGGTCATATGC[C/T]
ATCACATTTTCACCAGGAATTGAATCATCCACTGGAAGTGCAGCATCCATGTCATCTGGGCCTCCTACTCCAGCAACATTGACATCAGGGTCTCCTCCTT

Reverse complement sequence

AAGGAGGAGACCCTGATGTCAATGTTGCTGGAGTAGGAGGCCCAGATGACATGGATGCTGCACTTCCAGTGGATGATTCAATTCCTGGTGAAAATGTGAT[G/A]
GCATATGACCCTGACAACCCTTGCATGGATCTTGGAACTGCATACCCCAGCATGGAGGAGTTTAGATTGGCAATGAGACAGTTTGCTATTAACAACGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 0.20% 2.54% 20.59% NA
All Indica  2759 86.60% 0.30% 2.68% 10.40% NA
All Japonica  1512 62.90% 0.00% 1.12% 35.98% NA
Aus  269 44.20% 0.00% 9.29% 46.47% NA
Indica I  595 88.60% 1.30% 2.18% 7.90% NA
Indica II  465 79.10% 0.20% 2.80% 17.85% NA
Indica III  913 88.10% 0.00% 1.64% 10.30% NA
Indica Intermediate  786 87.80% 0.00% 4.20% 8.02% NA
Temperate Japonica  767 75.00% 0.00% 0.52% 24.51% NA
Tropical Japonica  504 46.80% 0.00% 1.98% 51.19% NA
Japonica Intermediate  241 58.10% 0.00% 1.24% 40.66% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 83.30% 0.00% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005364284 C -> T LOC_Os10g09900.1 missense_variant ; p.Met201Ile; MODERATE nonsynonymous_codon ; M201I Average:20.342; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 benign -0.086 TOLERATED 0.95
vg1005364284 C -> DEL LOC_Os10g09900.1 N frameshift_variant Average:20.342; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005364284 NA 3.16E-10 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 5.86E-06 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 1.23E-07 6.44E-25 mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 1.93E-06 4.11E-22 mr1855 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 5.84E-07 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.79E-08 mr1914 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 7.15E-08 mr1927 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.19E-09 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 5.36E-12 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.81E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.92E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 5.88E-09 1.03E-29 mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 1.68E-07 7.29E-27 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 2.80E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.13E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 4.34E-06 4.53E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.74E-16 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 3.92E-06 NA mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284 NA 1.25E-15 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251