\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004566535:

Variant ID: vg1004566535 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4566535
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGAAAAGAGAAATAAAATTAAACAACTGTTTTCGACTGGGGCGGACGGAGGATTTGGGTGGTGTCCGGAAAAGGCTAGTGCCGTCCCCAGTTAATTA[G/A]
GGACCGAGCCATGAAGTTAAGCATGAAACGACCCCCCGTACAACCGCACTTCTCGTATGGGTATAGACCTAGCGGAGTAGATAGCTGAGCGGAGGCAGTA

Reverse complement sequence

TACTGCCTCCGCTCAGCTATCTACTCCGCTAGGTCTATACCCATACGAGAAGTGCGGTTGTACGGGGGGTCGTTTCATGCTTAACTTCATGGCTCGGTCC[C/T]
TAATTAACTGGGGACGGCACTAGCCTTTTCCGGACACCACCCAAATCCTCCGTCCGCCCCAGTCGAAAACAGTTGTTTAATTTTATTTCTCTTTTCACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 15.70% 15.32% 33.28% NA
All Indica  2759 37.60% 1.60% 15.88% 44.91% NA
All Japonica  1512 36.40% 43.80% 2.05% 17.72% NA
Aus  269 1.50% 6.30% 81.04% 11.15% NA
Indica I  595 19.00% 1.00% 35.29% 44.71% NA
Indica II  465 29.90% 1.30% 11.83% 56.99% NA
Indica III  913 46.10% 1.10% 7.56% 45.24% NA
Indica Intermediate  786 46.40% 2.80% 13.23% 37.53% NA
Temperate Japonica  767 23.10% 70.70% 0.52% 5.74% NA
Tropical Japonica  504 60.70% 5.00% 3.97% 30.36% NA
Japonica Intermediate  241 27.80% 39.80% 2.90% 29.46% NA
VI/Aromatic  96 64.60% 0.00% 20.83% 14.58% NA
Intermediate  90 34.40% 22.20% 18.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004566535 G -> A LOC_Os10g08400.1 upstream_gene_variant ; 2536.0bp to feature; MODIFIER silent_mutation Average:25.457; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1004566535 G -> A LOC_Os10g08410.1 upstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:25.457; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1004566535 G -> A LOC_Os10g08400-LOC_Os10g08410 intergenic_region ; MODIFIER silent_mutation Average:25.457; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1004566535 G -> DEL N N silent_mutation Average:25.457; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004566535 NA 7.94E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 2.88E-07 2.13E-21 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 9.69E-08 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 1.72E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 1.25E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 8.80E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 9.72E-06 8.40E-16 mr1217_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 1.64E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 2.13E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 2.76E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 3.16E-07 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 1.64E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 3.15E-06 NA mr1318_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 8.92E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 9.13E-06 5.44E-08 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 2.00E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 2.67E-06 1.88E-16 mr1575_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 1.78E-06 1.43E-11 mr1606_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 9.07E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 1.04E-07 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 2.52E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 2.46E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 4.16E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 5.97E-07 1.15E-28 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 3.74E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 3.49E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 6.43E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 4.54E-06 4.16E-09 mr1869_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 6.18E-06 NA mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 6.18E-06 mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 7.44E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 2.59E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 3.86E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 4.74E-20 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004566535 NA 4.97E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251