\
| Variant ID: vg1004557426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4557426 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 232. )
TGGACGGAGGTGTCGCACTCTGCTCTTCTGGGATCAGACAGGGCAACGCCAGTTGTTTGGTACAGAAGTTTTAAATGAGGCAGAAGAGAAAGTCAGAGCT[G/A]
CCAGGGAAAGATTAAGAATAGCGCAATCTCGACAGAAAAGCTGTGCAGACAACCGCCGAAGGGAGCTCGCTTTCGAAGCAGGGGATTATGTGTATCTCTG
CAGAGATACACATAATCCCCTGCTTCGAAAGCGAGCTCCCTTCGGCGGTTGTCTGCACAGCTTTTCTGTCGAGATTGCGCTATTCTTAATCTTTCCCTGG[C/T]
AGCTCTGACTTTCTCTTCTGCCTCATTTAAAACTTCTGTACCAAACAACTGGCGTTGCCCTGTCTGATCCCAGAAGAGCAGAGTGCGACACCTCCGTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 24.40% | 3.43% | 13.18% | NA |
| All Indica | 2759 | 44.50% | 40.30% | 1.59% | 13.59% | NA |
| All Japonica | 1512 | 92.10% | 0.80% | 4.17% | 2.91% | NA |
| Aus | 269 | 11.20% | 2.60% | 17.47% | 68.77% | NA |
| Indica I | 595 | 20.30% | 40.70% | 2.69% | 36.30% | NA |
| Indica II | 465 | 42.80% | 47.30% | 1.51% | 8.39% | NA |
| Indica III | 913 | 55.20% | 40.40% | 0.66% | 3.72% | NA |
| Indica Intermediate | 786 | 51.30% | 35.90% | 1.91% | 10.94% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 80.40% | 0.00% | 11.51% | 8.13% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.90% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 84.40% | 1.00% | 3.12% | 11.46% | NA |
| Intermediate | 90 | 63.30% | 22.20% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004557426 | G -> A | LOC_Os10g08390.1 | missense_variant ; p.Ala736Thr; MODERATE | nonsynonymous_codon ; A736T | Average:35.801; most accessible tissue: Minghui63 flag leaf, score: 60.569 | benign |
0.344 |
DELETERIOUS | 0.00 |
| vg1004557426 | G -> DEL | LOC_Os10g08390.1 | N | frameshift_variant | Average:35.801; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004557426 | 4.35E-06 | 3.31E-09 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 2.91E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | 4.02E-06 | 4.00E-06 | mr1058_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | 8.74E-06 | NA | mr1220_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 1.07E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 4.84E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | 6.91E-06 | 6.91E-06 | mr1433_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 9.76E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 8.58E-06 | mr1603_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 4.63E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 3.00E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 5.65E-06 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | 3.58E-06 | 7.92E-08 | mr1852_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004557426 | NA | 4.04E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |