\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004296464:

Variant ID: vg1004296464 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4296464
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAAGGTTTATTTTGGCTACAATCTGAACAAGCCCTATATGACACATCTGTACAAGTTTAGAGACCATCCGTGCACTTCACATGCACTTCATTCCTTCT[A/T,C]
ACTATATGTATTGGGTTAATTTGATCCATGCCATTGTAACTTTGCCGATTTAGAACTATTTGTGATATCGGTTGGGTGCCACTGAAATTTTCCAAAATTG

Reverse complement sequence

CAATTTTGGAAAATTTCAGTGGCACCCAACCGATATCACAAATAGTTCTAAATCGGCAAAGTTACAATGGCATGGATCAAATTAACCCAATACATATAGT[T/A,G]
AGAAGGAATGAAGTGCATGTGAAGTGCACGGATGGTCTCTAAACTTGTACAGATGTGTCATATAGGGCTTGTTCAGATTGTAGCCAAAATAAACCTTACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.50% 0.60% 0.51% 0.44% NA
All Indica  2759 97.50% 1.00% 0.80% 0.72% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 93.80% 3.50% 2.35% 0.34% NA
Indica II  465 99.40% 0.00% 0.43% 0.22% NA
Indica III  913 98.50% 0.00% 0.11% 1.42% NA
Indica Intermediate  786 98.00% 0.90% 0.64% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004296464 A -> C LOC_Os10g07998.1 upstream_gene_variant ; 1559.0bp to feature; MODIFIER N Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1004296464 A -> C LOC_Os10g08002.1 downstream_gene_variant ; 4011.0bp to feature; MODIFIER N Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1004296464 A -> C LOC_Os10g07998-LOC_Os10g08002 intergenic_region ; MODIFIER N Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1004296464 A -> T LOC_Os10g07998.1 upstream_gene_variant ; 1559.0bp to feature; MODIFIER silent_mutation Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1004296464 A -> T LOC_Os10g08002.1 downstream_gene_variant ; 4011.0bp to feature; MODIFIER silent_mutation Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1004296464 A -> T LOC_Os10g07998-LOC_Os10g08002 intergenic_region ; MODIFIER silent_mutation Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1004296464 A -> DEL N N silent_mutation Average:46.915; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004296464 NA 1.80E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 4.77E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 6.48E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 2.19E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 5.52E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 5.30E-06 5.30E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 9.52E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 5.36E-06 5.36E-06 mr1930 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 4.41E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 2.47E-07 4.36E-11 mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 3.67E-06 NA mr1070_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 4.43E-08 9.74E-13 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 1.80E-06 3.62E-09 mr1147_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 1.42E-06 1.42E-06 mr1151_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 1.29E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 1.42E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 1.26E-07 3.23E-11 mr1204_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 1.54E-06 1.54E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 9.53E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 3.66E-07 7.99E-09 mr1264_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 1.02E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004296464 NA 3.81E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251