\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003712007:

Variant ID: vg1003712007 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3712007
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, T: 0.38, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTACCCCCGCGTGCTACCCGCCATGGCCTGACGACATGGACAAAAGCTACAGCTTATTTGTACTCCTAATTCACAATTAAAAAAACACCTTTTAATTT[T/A]
ATTTATTTATTTTTTGTATGTTTTGTAGAGAAAGATTGGCAATGAACAGCGAGGAAGAGAGATGCTTGCCTTCCGTTGCGTTGCGTTGCGTTGCTTGCAC

Reverse complement sequence

GTGCAAGCAACGCAACGCAACGCAACGGAAGGCAAGCATCTCTCTTCCTCGCTGTTCATTGCCAATCTTTCTCTACAAAACATACAAAAAATAAATAAAT[A/T]
AAATTAAAAGGTGTTTTTTTAATTGTGAATTAGGAGTACAAATAAGCTGTAGCTTTTGTCCATGTCGTCAGGCCATGGCGGGTAGCACGCGGGGGTAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.10% 31.50% 0.25% 23.13% NA
All Indica  2759 57.70% 2.70% 0.36% 39.22% NA
All Japonica  1512 13.60% 86.10% 0.07% 0.20% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 64.40% 2.50% 0.34% 32.77% NA
Indica II  465 63.70% 0.40% 0.43% 35.48% NA
Indica III  913 45.50% 4.20% 0.44% 49.95% NA
Indica Intermediate  786 63.40% 2.50% 0.25% 33.84% NA
Temperate Japonica  767 9.50% 90.20% 0.00% 0.26% NA
Tropical Japonica  504 18.80% 81.00% 0.20% 0.00% NA
Japonica Intermediate  241 15.80% 83.80% 0.00% 0.41% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 51.10% 38.90% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003712007 T -> A LOC_Os10g07060.1 upstream_gene_variant ; 4411.0bp to feature; MODIFIER silent_mutation Average:25.36; most accessible tissue: Callus, score: 72.252 N N N N
vg1003712007 T -> A LOC_Os10g07050-LOC_Os10g07060 intergenic_region ; MODIFIER silent_mutation Average:25.36; most accessible tissue: Callus, score: 72.252 N N N N
vg1003712007 T -> DEL N N silent_mutation Average:25.36; most accessible tissue: Callus, score: 72.252 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003712007 NA 3.84E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 6.96E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 3.79E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 1.09E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 3.79E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 5.90E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 3.28E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 6.78E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 6.81E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 1.48E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 4.68E-06 1.65E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 1.52E-06 1.51E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 5.16E-06 5.16E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 2.71E-06 mr1557_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 3.58E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 1.76E-06 1.76E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 8.88E-07 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 2.66E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 4.47E-06 4.47E-06 mr1637_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 6.28E-06 6.28E-06 mr1649_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 1.06E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003712007 NA 5.54E-06 mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251