\
| Variant ID: vg1002941120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2941120 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 43. )
GTCAGGCCGACACGGCCCGACTTATACGCCGGGGCATGCCATGCCAGCCCATGGGCTGCACACACAACCCAGGCCCAGTAAGACTCGGGTCGTGTTGAGC[T/C]
AGCCCGAAGGCACGACAGCCTATCGTGTTTCTTCATAGAATAAGTCTATTTGTTCTTCCTAAACCTCTGTGGGCTGTGTCCATATGGCTGGAAAATAAGT
ACTTATTTTCCAGCCATATGGACACAGCCCACAGAGGTTTAGGAAGAACAAATAGACTTATTCTATGAAGAAACACGATAGGCTGTCGTGCCTTCGGGCT[A/G]
GCTCAACACGACCCGAGTCTTACTGGGCCTGGGTTGTGTGTGCAGCCCATGGGCTGGCATGGCATGCCCCGGCGTATAAGTCGGGCCGTGTCGGCCTGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.30% | 19.90% | 0.42% | 53.45% | NA |
| All Indica | 2759 | 10.90% | 2.50% | 0.69% | 85.90% | NA |
| All Japonica | 1512 | 45.50% | 53.10% | 0.00% | 1.39% | NA |
| Aus | 269 | 76.20% | 11.90% | 0.00% | 11.90% | NA |
| Indica I | 595 | 2.40% | 3.70% | 1.34% | 92.61% | NA |
| Indica II | 465 | 31.20% | 2.60% | 0.86% | 65.38% | NA |
| Indica III | 913 | 4.80% | 0.50% | 0.44% | 94.19% | NA |
| Indica Intermediate | 786 | 12.50% | 3.80% | 0.38% | 83.33% | NA |
| Temperate Japonica | 767 | 13.30% | 86.20% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 89.70% | 7.70% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 55.60% | 42.70% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 16.70% | 9.40% | 0.00% | 73.96% | NA |
| Intermediate | 90 | 34.40% | 28.90% | 1.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002941120 | T -> C | LOC_Os10g05810.1 | upstream_gene_variant ; 1317.0bp to feature; MODIFIER | silent_mutation | Average:32.292; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1002941120 | T -> C | LOC_Os10g05820.1 | downstream_gene_variant ; 681.0bp to feature; MODIFIER | silent_mutation | Average:32.292; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1002941120 | T -> C | LOC_Os10g05810-LOC_Os10g05820 | intergenic_region ; MODIFIER | silent_mutation | Average:32.292; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg1002941120 | T -> DEL | N | N | silent_mutation | Average:32.292; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002941120 | NA | 3.32E-06 | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 5.46E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 1.29E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.72E-07 | 6.68E-06 | mr1054 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 8.47E-08 | 8.47E-08 | mr1054 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 4.84E-06 | 4.84E-06 | mr1187 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 3.39E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 2.26E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 6.68E-06 | mr1272 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 9.46E-06 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 7.65E-07 | NA | mr1287 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 3.72E-07 | 3.72E-07 | mr1287 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 9.74E-07 | NA | mr1327 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 6.02E-08 | 2.56E-07 | mr1327 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 8.67E-07 | NA | mr1331 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 2.41E-08 | 2.41E-08 | mr1331 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 5.18E-06 | 5.18E-06 | mr1337 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.07E-06 | NA | mr1372 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 9.56E-07 | 2.89E-07 | mr1372 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 7.66E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.04E-07 | 2.22E-08 | mr1427 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.76E-06 | 8.50E-07 | mr1432 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 7.52E-06 | 2.95E-06 | mr1433 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 5.67E-09 | 5.67E-09 | mr1462 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 5.11E-06 | mr1500 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 7.00E-06 | mr1509 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 5.02E-07 | 5.02E-07 | mr1512 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.87E-06 | NA | mr1515 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.54E-07 | 3.31E-08 | mr1515 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 6.80E-07 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 3.19E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 1.41E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 6.69E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 3.35E-06 | 6.50E-07 | mr1634 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 3.46E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 7.70E-06 | mr1680 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 5.24E-06 | NA | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 3.88E-06 | 3.88E-06 | mr1724 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 1.98E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 3.11E-06 | NA | mr1972 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.83E-07 | 1.83E-07 | mr1972 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 5.45E-06 | mr1986 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 2.51E-06 | mr1020_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 5.79E-06 | mr1189_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 2.10E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.31E-06 | 2.05E-07 | mr1216_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 3.78E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 7.68E-06 | 5.71E-08 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 3.30E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 8.60E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 4.69E-06 | NA | mr1462_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 5.69E-06 | NA | mr1472_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 5.61E-07 | mr1472_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.25E-06 | 1.40E-07 | mr1734_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.49E-06 | NA | mr1879_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 5.33E-07 | mr1879_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 2.86E-06 | NA | mr1899_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 1.41E-06 | 7.56E-09 | mr1899_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | 4.14E-06 | 3.34E-07 | mr1933_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002941120 | NA | 1.08E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |