\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001404249:

Variant ID: vg1001404249 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1404249
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTGGCGTGCGTGCATCACGTCGCTATTCTTTTGCAACCACGAACCCACGTTCCCACGACTGTCTCCGCAACGGCGCGTCCACGATCCCACGTTCCCAC[A/G]
ACTGCCTCTCTCCTGATAGATAAGGAGGCCGCGATTCCGATCAAAACGATCCGCTTGCTTCTTTCCCGGGTGTTAGTTCCTCCTCCTCCGCACCTGTGCT

Reverse complement sequence

AGCACAGGTGCGGAGGAGGAGGAACTAACACCCGGGAAAGAAGCAAGCGGATCGTTTTGATCGGAATCGCGGCCTCCTTATCTATCAGGAGAGAGGCAGT[T/C]
GTGGGAACGTGGGATCGTGGACGCGCCGTTGCGGAGACAGTCGTGGGAACGTGGGTTCGTGGTTGCAAAAGAATAGCGACGTGATGCACGCACGCCAGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 19.70% 6.18% 0.00% NA
All Indica  2759 81.50% 10.30% 8.23% 0.00% NA
All Japonica  1512 60.90% 38.90% 0.20% 0.00% NA
Aus  269 68.40% 13.00% 18.59% 0.00% NA
Indica I  595 94.60% 2.20% 3.19% 0.00% NA
Indica II  465 83.00% 5.60% 11.40% 0.00% NA
Indica III  913 72.20% 17.70% 10.08% 0.00% NA
Indica Intermediate  786 81.40% 10.60% 8.02% 0.00% NA
Temperate Japonica  767 28.60% 71.40% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 86.30% 12.90% 0.83% 0.00% NA
VI/Aromatic  96 89.60% 3.10% 7.29% 0.00% NA
Intermediate  90 71.10% 23.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001404249 A -> G LOC_Os10g03320.1 upstream_gene_variant ; 1457.0bp to feature; MODIFIER silent_mutation Average:75.975; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1001404249 A -> G LOC_Os10g03300.1 downstream_gene_variant ; 4768.0bp to feature; MODIFIER silent_mutation Average:75.975; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1001404249 A -> G LOC_Os10g03310.1 downstream_gene_variant ; 625.0bp to feature; MODIFIER silent_mutation Average:75.975; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1001404249 A -> G LOC_Os10g03330.1 downstream_gene_variant ; 3504.0bp to feature; MODIFIER silent_mutation Average:75.975; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1001404249 A -> G LOC_Os10g03310-LOC_Os10g03320 intergenic_region ; MODIFIER silent_mutation Average:75.975; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1001404249 A G 0.02 0.0 0.0 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001404249 NA 1.85E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 2.28E-06 2.28E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 9.18E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 6.34E-09 1.85E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 4.65E-07 2.77E-16 mr1486 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 2.82E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 4.08E-10 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 4.85E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 1.92E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 1.58E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 7.88E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 5.36E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 6.63E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 1.48E-07 5.44E-34 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 6.83E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 1.69E-11 1.06E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 3.42E-09 1.49E-18 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 2.02E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001404249 NA 4.79E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251