\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000821084:

Variant ID: vg1000821084 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 821084
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAACTGAAGCTCAAAAGGAGGATTTCACAAACGAAGTTATCATACAATCGCGAATGATGCACAATAACATTATCAAGCTATTGGGCTGTTGTTTGGAG[A/G]
TGGATGTTCCAATGTTGGTATATGAGTTTGCCGCTAATGGTAGCCTAAAAGACATTCTCCATAGTGATGCCAGTCACCTAGTCCCTCTCACACTAGATCT

Reverse complement sequence

AGATCTAGTGTGAGAGGGACTAGGTGACTGGCATCACTATGGAGAATGTCTTTTAGGCTACCATTAGCGGCAAACTCATATACCAACATTGGAACATCCA[T/C]
CTCCAAACAACAGCCCAATAGCTTGATAATGTTATTGTGCATCATTCGCGATTGTATGATAACTTCGTTTGTGAAATCCTCCTTTTGAGCTTCAGTTACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 16.20% 0.32% 32.88% NA
All Indica  2759 50.70% 0.80% 0.43% 48.13% NA
All Japonica  1512 49.70% 47.80% 0.00% 2.45% NA
Aus  269 63.60% 1.10% 1.12% 34.20% NA
Indica I  595 37.00% 1.20% 0.67% 61.18% NA
Indica II  465 77.80% 0.60% 0.22% 21.29% NA
Indica III  913 50.10% 0.10% 0.11% 49.73% NA
Indica Intermediate  786 45.70% 1.30% 0.76% 52.29% NA
Temperate Japonica  767 22.30% 77.30% 0.00% 0.39% NA
Tropical Japonica  504 93.10% 4.80% 0.00% 2.18% NA
Japonica Intermediate  241 46.50% 44.00% 0.00% 9.54% NA
VI/Aromatic  96 12.50% 1.00% 0.00% 86.46% NA
Intermediate  90 66.70% 17.80% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000821084 A -> G LOC_Os10g02284.1 missense_variant ; p.Met248Val; MODERATE nonsynonymous_codon ; M248V Average:19.215; most accessible tissue: Callus, score: 41.26 benign -0.364 TOLERATED 1.00
vg1000821084 A -> DEL LOC_Os10g02284.1 N frameshift_variant Average:19.215; most accessible tissue: Callus, score: 41.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000821084 3.18E-06 9.65E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000821084 4.80E-07 1.09E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000821084 1.54E-06 4.11E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000821084 2.58E-06 3.56E-07 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000821084 NA 9.51E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000821084 6.66E-07 2.43E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251