\
| Variant ID: vg1000821084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 821084 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTAACTGAAGCTCAAAAGGAGGATTTCACAAACGAAGTTATCATACAATCGCGAATGATGCACAATAACATTATCAAGCTATTGGGCTGTTGTTTGGAG[A/G]
TGGATGTTCCAATGTTGGTATATGAGTTTGCCGCTAATGGTAGCCTAAAAGACATTCTCCATAGTGATGCCAGTCACCTAGTCCCTCTCACACTAGATCT
AGATCTAGTGTGAGAGGGACTAGGTGACTGGCATCACTATGGAGAATGTCTTTTAGGCTACCATTAGCGGCAAACTCATATACCAACATTGGAACATCCA[T/C]
CTCCAAACAACAGCCCAATAGCTTGATAATGTTATTGTGCATCATTCGCGATTGTATGATAACTTCGTTTGTGAAATCCTCCTTTTGAGCTTCAGTTACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 16.20% | 0.32% | 32.88% | NA |
| All Indica | 2759 | 50.70% | 0.80% | 0.43% | 48.13% | NA |
| All Japonica | 1512 | 49.70% | 47.80% | 0.00% | 2.45% | NA |
| Aus | 269 | 63.60% | 1.10% | 1.12% | 34.20% | NA |
| Indica I | 595 | 37.00% | 1.20% | 0.67% | 61.18% | NA |
| Indica II | 465 | 77.80% | 0.60% | 0.22% | 21.29% | NA |
| Indica III | 913 | 50.10% | 0.10% | 0.11% | 49.73% | NA |
| Indica Intermediate | 786 | 45.70% | 1.30% | 0.76% | 52.29% | NA |
| Temperate Japonica | 767 | 22.30% | 77.30% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 93.10% | 4.80% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 46.50% | 44.00% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 12.50% | 1.00% | 0.00% | 86.46% | NA |
| Intermediate | 90 | 66.70% | 17.80% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000821084 | A -> G | LOC_Os10g02284.1 | missense_variant ; p.Met248Val; MODERATE | nonsynonymous_codon ; M248V | Average:19.215; most accessible tissue: Callus, score: 41.26 | benign |
-0.364 |
TOLERATED | 1.00 |
| vg1000821084 | A -> DEL | LOC_Os10g02284.1 | N | frameshift_variant | Average:19.215; most accessible tissue: Callus, score: 41.26 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000821084 | 3.18E-06 | 9.65E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000821084 | 4.80E-07 | 1.09E-06 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000821084 | 1.54E-06 | 4.11E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000821084 | 2.58E-06 | 3.56E-07 | mr1765 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000821084 | NA | 9.51E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000821084 | 6.66E-07 | 2.43E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |