| Variant ID: vg1000636049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 636049 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGCATTATATTACATATCTATCAGTTGGAAGAGCTTGTCAAAAACCTTCTCCTCTTTATTCATTGAGTCGTACACAGTGACTCTGCATGCGTCCAAGTC[G/A]
AAAAAGAACAGGACCCAGTGGAATCTAGAATATGCGTGATATGAGATAAATATCAGAATGTACATGTTATATGTATGGGAACGAAATTTGTTCGAACAAC
GTTGTTCGAACAAATTTCGTTCCCATACATATAACATGTACATTCTGATATTTATCTCATATCACGCATATTCTAGATTCCACTGGGTCCTGTTCTTTTT[C/T]
GACTTGGACGCATGCAGAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACAAGCTCTTCCAACTGATAGATATGTAATATAATGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.70% | 1.20% | 8.29% | 42.78% | NA |
| All Indica | 2759 | 35.50% | 0.00% | 7.83% | 56.69% | NA |
| All Japonica | 1512 | 66.50% | 3.80% | 3.84% | 25.79% | NA |
| Aus | 269 | 49.40% | 0.00% | 37.17% | 13.38% | NA |
| Indica I | 595 | 35.10% | 0.00% | 4.03% | 60.84% | NA |
| Indica II | 465 | 35.70% | 0.00% | 5.16% | 59.14% | NA |
| Indica III | 913 | 32.70% | 0.00% | 10.84% | 56.41% | NA |
| Indica Intermediate | 786 | 38.80% | 0.00% | 8.78% | 52.42% | NA |
| Temperate Japonica | 767 | 82.30% | 6.90% | 0.13% | 10.69% | NA |
| Tropical Japonica | 504 | 47.00% | 0.00% | 8.73% | 44.25% | NA |
| Japonica Intermediate | 241 | 57.30% | 2.10% | 5.39% | 35.27% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 8.33% | 8.33% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 11.11% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000636049 | G -> A | LOC_Os10g02000.1 | downstream_gene_variant ; 2749.0bp to feature; MODIFIER | silent_mutation | Average:7.753; most accessible tissue: Callus, score: 34.463 | N | N | N | N |
| vg1000636049 | G -> A | LOC_Os10g02010.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.753; most accessible tissue: Callus, score: 34.463 | N | N | N | N |
| vg1000636049 | G -> DEL | N | N | silent_mutation | Average:7.753; most accessible tissue: Callus, score: 34.463 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000636049 | 1.25E-06 | 1.45E-10 | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000636049 | NA | 2.24E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000636049 | 6.66E-08 | 1.67E-13 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000636049 | 3.16E-09 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000636049 | 1.92E-06 | 1.37E-10 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000636049 | 7.79E-06 | 3.00E-07 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000636049 | NA | 1.33E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |