| Variant ID: vg1000625785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 625785 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAATGATTTAAAATTGTTAAAAATTCTAATAATCATATATAACTAACATATGCATGATATTAAATTGTTAAAAATTCTAATTAACCTATGTAAATACCA[C/T]
ATGCATGATTTAAAATTAATAAAAATTCTAATAATCATATATAATTAGCATATGCATGATATTAAATTGTTAAAAATTCTAATTAACATATGTAAATCCC
GGGATTTACATATGTTAATTAGAATTTTTAACAATTTAATATCATGCATATGCTAATTATATATGATTATTAGAATTTTTATTAATTTTAAATCATGCAT[G/A]
TGGTATTTACATAGGTTAATTAGAATTTTTAACAATTTAATATCATGCATATGTTAGTTATATATGATTATTAGAATTTTTAACAATTTTAAATCATTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 0.50% | 7.87% | 27.57% | NA |
| All Indica | 2759 | 65.10% | 0.40% | 7.36% | 27.11% | NA |
| All Japonica | 1512 | 56.20% | 0.70% | 10.78% | 32.34% | NA |
| Aus | 269 | 97.00% | 0.00% | 0.37% | 2.60% | NA |
| Indica I | 595 | 65.70% | 0.00% | 5.04% | 29.24% | NA |
| Indica II | 465 | 61.10% | 0.90% | 7.31% | 30.75% | NA |
| Indica III | 913 | 63.40% | 0.40% | 9.86% | 26.29% | NA |
| Indica Intermediate | 786 | 69.10% | 0.40% | 6.23% | 24.30% | NA |
| Temperate Japonica | 767 | 81.60% | 0.40% | 2.74% | 15.25% | NA |
| Tropical Japonica | 504 | 16.30% | 1.40% | 24.01% | 58.33% | NA |
| Japonica Intermediate | 241 | 58.90% | 0.00% | 8.71% | 32.37% | NA |
| VI/Aromatic | 96 | 64.60% | 0.00% | 2.08% | 33.33% | NA |
| Intermediate | 90 | 64.40% | 2.20% | 3.33% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000625785 | C -> T | LOC_Os10g01984.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.692; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 | N | N | N | N |
| vg1000625785 | C -> DEL | N | N | silent_mutation | Average:12.692; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000625785 | 8.08E-06 | 8.07E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 6.33E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 3.46E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 3.13E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 1.74E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 1.31E-10 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 2.89E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | 7.61E-06 | 1.30E-12 | mr1251 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 9.61E-08 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000625785 | NA | 5.40E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/