\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000467020:

Variant ID: vg1000467020 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 467020
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.11, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AAACATTGTGAGTACACTAGGTGAAACATTTTTGGTGGAACAAAAAATAAACCAAATTCCCTTAATAGAGGGGTTCCAAAATATGTGGGTTTTTTTGTTG[C/T]
AAAAGAATATTTTATTTCACTGCAACATTAGATCTACAAATAGTGAAACATTGTAAATATATTAGGTGAAACATCTTTTGTGGAAAAAAGGGAGGGAGAA

Reverse complement sequence

TTCTCCCTCCCTTTTTTCCACAAAAGATGTTTCACCTAATATATTTACAATGTTTCACTATTTGTAGATCTAATGTTGCAGTGAAATAAAATATTCTTTT[G/A]
CAACAAAAAAACCCACATATTTTGGAACCCCTCTATTAAGGGAATTTGGTTTATTTTTTGTTCCACCAAAAATGTTTCACCTAGTGTACTCACAATGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 18.50% 0.15% 15.09% NA
All Indica  2759 81.80% 0.70% 0.22% 17.33% NA
All Japonica  1512 45.40% 53.90% 0.00% 0.66% NA
Aus  269 32.00% 4.10% 0.37% 63.57% NA
Indica I  595 62.50% 1.30% 1.01% 35.13% NA
Indica II  465 97.60% 0.40% 0.00% 1.94% NA
Indica III  913 88.50% 0.10% 0.00% 11.39% NA
Indica Intermediate  786 79.10% 1.00% 0.00% 19.85% NA
Temperate Japonica  767 12.80% 86.80% 0.00% 0.39% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 47.70% 0.00% 2.90% NA
VI/Aromatic  96 45.80% 9.40% 0.00% 44.79% NA
Intermediate  90 64.40% 23.30% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000467020 C -> T LOC_Os10g01720.1 upstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:41.75; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1000467020 C -> T LOC_Os10g01710-LOC_Os10g01720 intergenic_region ; MODIFIER silent_mutation Average:41.75; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1000467020 C -> DEL N N silent_mutation Average:41.75; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000467020 NA 7.98E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 1.55E-06 1.55E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 4.42E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 3.31E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 7.16E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.49E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.34E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 6.79E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 8.00E-10 6.19E-28 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 3.25E-06 3.74E-10 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 1.43E-09 5.56E-39 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 4.64E-06 4.88E-12 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 3.88E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 2.31E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 4.09E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 3.13E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 8.68E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.71E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 3.77E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 6.51E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.95E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 2.50E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 7.20E-07 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 5.78E-12 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.16E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 2.51E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 6.33E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 2.27E-06 2.27E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 3.77E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 6.59E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.33E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 3.50E-10 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.60E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 2.33E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 1.78E-11 1.13E-46 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 2.58E-06 3.39E-13 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 7.82E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 5.16E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 1.41E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 1.62E-10 4.18E-37 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 6.00E-07 7.14E-15 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 7.56E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 6.59E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 5.31E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 6.28E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 5.58E-06 mr1706_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 2.51E-06 1.44E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000467020 NA 7.56E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251