Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922903600:

Variant ID: vg0922903600 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22903600
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTACTCCTAGTTAGTTAGCTAAGCTACTCCATATATTTACATTTTCGGAATACAACAAACAAAGAAACAAACATTGTATATTTTCATGGATAAATGAA[T/C]
GGACAGTGACTTACCGGCACAAGCGCGTGGCGGACGAGATCCTGAAGATCGGCAAGGGGAAGGTGACGGCGCGGGCGTTCACGTACGGCGAGCTGTCGGA

Reverse complement sequence

TCCGACAGCTCGCCGTACGTGAACGCCCGCGCCGTCACCTTCCCCTTGCCGATCTTCAGGATCTCGTCCGCCACGCGCTTGTGCCGGTAAGTCACTGTCC[A/G]
TTCATTTATCCATGAAAATATACAATGTTTGTTTCTTTGTTTGTTGTATTCCGAAAATGTAAATATATGGAGTAGCTTAGCTAACTAACTAGGAGTACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	38.00%	0.04%	0.28%	NA
All Indica	2759	97.90%	1.70%	0.07%	0.25%	NA
All Japonica	1512	0.60%	99.30%	0.00%	0.13%	NA
Aus	269	63.60%	36.40%	0.00%	0.00%	NA
Indica I	595	98.80%	0.70%	0.17%	0.34%	NA
Indica II	465	97.20%	2.40%	0.00%	0.43%	NA
Indica III	913	98.60%	1.30%	0.00%	0.11%	NA
Indica Intermediate	786	96.90%	2.70%	0.13%	0.25%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.00%	0.20%	NA
Japonica Intermediate	241	0.80%	98.80%	0.00%	0.41%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	32.20%	63.30%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922903600	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922903600	T -> C	LOC_Os09g39930.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922903600	T -> C	LOC_Os09g39940.1	upstream_gene_variant ; 4252.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922903600	T -> C	LOC_Os09g39920.1	downstream_gene_variant ; 969.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0922903600	T	C	-0.02	-0.02	-0.03	-0.02	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922903600	NA	3.62E-17	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0922903600	NA	9.84E-39	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	1.18E-43	mr1092	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	2.54E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	8.33E-43	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	2.27E-71	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	4.16E-60	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	2.58E-33	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	1.31E-14	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	2.85E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	7.77E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922903600	NA	3.67E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251