\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921571697:

Variant ID: vg0921571697 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 21571697
Reference Allele: AAlternative Allele: AG,G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATACGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTTTAAATAAGACGAACGGTCAAACGTTGGACACGAAAATCAGGGTTTGCCTTTTTTTTTTG[A/AG,G,T]
GACGGAGGGAGTATGATCTCGACCTGACAGTCTGCATTGTCGCTGGCAGTTTTGGATGGGACACGAGAAAAAGAGGGCAAACTGAGCGCGACGGCCAGCC

Reverse complement sequence

GGCTGGCCGTCGCGCTCAGTTTGCCCTCTTTTTCTCGTGTCCCATCCAAAACTGCCAGCGACAATGCAGACTGTCAGGTCGAGATCATACTCCCTCCGTC[T/CT,C,A]
CAAAAAAAAAAGGCAAACCCTGATTTTCGTGTCCAACGTTTGACCGTTCGTCTTATTTAAAAAAATTATGAAAAAAATTAAAAAGACAAGTCACGTATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 22.70% 1.18% 0.13% T: 0.04%
All Indica  2759 96.70% 1.30% 1.74% 0.22% T: 0.07%
All Japonica  1512 46.00% 53.80% 0.20% 0.00% NA
Aus  269 54.30% 44.60% 1.12% 0.00% NA
Indica I  595 95.00% 0.00% 5.04% 0.00% NA
Indica II  465 96.30% 1.10% 2.37% 0.22% NA
Indica III  913 98.00% 1.20% 0.22% 0.44% T: 0.11%
Indica Intermediate  786 96.60% 2.50% 0.64% 0.13% T: 0.13%
Temperate Japonica  767 72.50% 27.40% 0.13% 0.00% NA
Tropical Japonica  504 8.90% 90.90% 0.20% 0.00% NA
Japonica Intermediate  241 39.40% 60.20% 0.41% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921571697 A -> G LOC_Os09g37350.1 upstream_gene_variant ; 1815.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> G LOC_Os09g37340.1 downstream_gene_variant ; 3644.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> G LOC_Os09g37344.1 downstream_gene_variant ; 810.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> G LOC_Os09g37360.1 downstream_gene_variant ; 2965.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> G LOC_Os09g37344-LOC_Os09g37360 intergenic_region ; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> DEL N N silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> T LOC_Os09g37350.1 upstream_gene_variant ; 1815.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> T LOC_Os09g37340.1 downstream_gene_variant ; 3644.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> T LOC_Os09g37344.1 downstream_gene_variant ; 810.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> T LOC_Os09g37360.1 downstream_gene_variant ; 2965.0bp to feature; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> T LOC_Os09g37344-LOC_Os09g37360 intergenic_region ; MODIFIER silent_mutation Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> AG LOC_Os09g37350.1 upstream_gene_variant ; 1816.0bp to feature; MODIFIER N Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> AG LOC_Os09g37340.1 downstream_gene_variant ; 3645.0bp to feature; MODIFIER N Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> AG LOC_Os09g37344.1 downstream_gene_variant ; 811.0bp to feature; MODIFIER N Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> AG LOC_Os09g37360.1 downstream_gene_variant ; 2964.0bp to feature; MODIFIER N Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N
vg0921571697 A -> AG LOC_Os09g37344-LOC_Os09g37360 intergenic_region ; MODIFIER N Average:86.187; most accessible tissue: Minghui63 flower, score: 93.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921571697 A AG -0.1 -0.16 0.09 0.03 -0.05 -0.07
vg0921571697 A G -0.09 -0.08 -0.05 0.03 0.01 0.01
vg0921571697 A T 0.03 0.0 0.03 0.03 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921571697 NA 1.15E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0921571697 NA 4.10E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.92E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 7.03E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.23E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 5.31E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.72E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.84E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.54E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 2.76E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.76E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.07E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 6.37E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.15E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.23E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 9.68E-10 mr1308_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 6.07E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.48E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.08E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.72E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 8.73E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.77E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.51E-09 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.27E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.50E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.82E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 7.27E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.78E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 4.60E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.42E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 6.21E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.58E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 2.08E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 5.91E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 6.85E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.03E-08 mr1853_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 1.20E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921571697 NA 3.04E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251