RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0920307704:

Variant ID: vg0920307704 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 20307704
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTTCTGTGCACTTTGAGTTTTATTTTCTTTCTTGGAACTCAGGACTTCTGATGATGATAGATTGATAGCTCTATTTTATTCATTCATGCATATTTGCT[T/C]
CATATTGTTCTTGATTCAGTAGCTAGGCTGGTTGAGAGGGATAATTGATAAATTGTATTTCCTATCTTCTGAGATTTCTTCTAACCGTGCATGTCAGCTA

Reverse complement sequence

TAGCTGACATGCACGGTTAGAAGAAATCTCAGAAGATAGGAAATACAATTTATCAATTATCCCTCTCAACCAGCCTAGCTACTGAATCAAGAACAATATG[A/G]
AGCAAATATGCATGAATGAATAAAATAGAGCTATCAATCTATCATCATCAGAAGTCCTGAGTTCCAAGAAAGAAAATAAAACTCAAAGTGCACAGAACTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	8.80%	5.23%	26.98%	NA
All Indica	2759	35.60%	14.90%	8.81%	40.67%	NA
All Japonica	1512	96.60%	0.10%	0.07%	3.24%	NA
Aus	269	63.60%	0.40%	0.74%	35.32%	NA
Indica I	595	54.50%	1.00%	17.14%	27.39%	NA
Indica II	465	48.20%	1.70%	6.67%	43.44%	NA
Indica III	913	18.30%	24.40%	5.48%	51.81%	NA
Indica Intermediate	786	34.10%	22.10%	7.63%	36.13%	NA
Temperate Japonica	767	97.10%	0.00%	0.13%	2.74%	NA
Tropical Japonica	504	95.40%	0.20%	0.00%	4.37%	NA
Japonica Intermediate	241	97.50%	0.00%	0.00%	2.49%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	4.40%	1.11%	10.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0920307704	T -> DEL	N	N	silent_mutation	Average:57.982; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0920307704	T -> C	LOC_Os09g34847.1	3_prime_UTR_variant ; 1134.0bp to feature; MODIFIER	silent_mutation	Average:57.982; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0920307704	T -> C	LOC_Os09g34847.2	3_prime_UTR_variant ; 1134.0bp to feature; MODIFIER	silent_mutation	Average:57.982; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0920307704	NA	1.51E-13	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	NA	7.74E-14	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	1.79E-06	NA	mr1078	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	9.24E-07	7.64E-15	mr1078	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	1.49E-06	NA	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	NA	4.04E-15	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	NA	1.69E-12	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	NA	4.00E-14	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	NA	6.95E-10	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920307704	NA	2.34E-10	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 51 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg0920307704:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact