Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0919844661:

Variant ID: vg0919844661 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19844661
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TGTATGGAGTTGGTGAATGTGGTTTTTCCTTCTCCTCGAGTTTGCGTGAATGTGGAAAAACTTTGTGTTGGCATCCCCTTCTTTTAGCCATGTCAATCGC[G/A]
ATCTCTGCCTTTTCTTCGACTTTGCCACTGCTGCCAGCCCCAAAATTCTTAGCTTGAGGTCTTTCCTGAGCTGGTGTTCATCAGCAGTAAGGATCCTATC

Reverse complement sequence

GATAGGATCCTTACTGCTGATGAACACCAGCTCAGGAAAGACCTCAAGCTAAGAATTTTGGGGCTGGCAGCAGTGGCAAAGTCGAAGAAAAGGCAGAGAT[C/T]
GCGATTGACATGGCTAAAAGAAGGGGATGCCAACACAAAGTTTTTCCACATTCACGCAAACTCGAGGAGAAGGAAAAACCACATTCACCAACTCCATACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 6.20% 2.71% 4.04% NA
All Indica  2759 92.90% 2.70% 2.10% 2.28% NA
All Japonica  1512 83.80% 14.20% 1.98% 0.00% NA
Aus  269 42.80% 0.00% 12.64% 44.61% NA
Indica I  595 99.20% 0.20% 0.17% 0.50% NA
Indica II  465 96.10% 0.00% 1.72% 2.15% NA
Indica III  913 89.30% 6.20% 1.97% 2.52% NA
Indica Intermediate  786 90.50% 2.20% 3.94% 3.44% NA
Temperate Japonica  767 96.60% 2.20% 1.17% 0.00% NA
Tropical Japonica  504 76.20% 22.40% 1.39% 0.00% NA
Japonica Intermediate  241 58.90% 35.30% 5.81% 0.00% NA
VI/Aromatic  96 90.60% 4.20% 3.12% 2.08% NA
Intermediate  90 88.90% 1.10% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919844661 G -> DEL LOC_Os09g33610.1 N frameshift_variant Average:37.312; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg0919844661 G -> A LOC_Os09g33610.1 missense_variant ; p.Ser1203Leu; MODERATE nonsynonymous_codon ; S1203L Average:37.312; most accessible tissue: Minghui63 root, score: 45.031 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919844661 NA 6.51E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919844661 4.21E-06 2.19E-07 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919844661 NA 5.77E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251