Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0919119587:

Variant ID: vg0919119587 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 19119587
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCTCTTGGCACCAATAATTATCGTCTCTAATGTGATAGTTAATACAATGATTCACGTAGTCTAACAACAGATAAGGAGAATGTTGGCATCATGGTGCC[T/C]
CACTTCTGAACTTGGCGAGCAGTCACCAGGTGACATTGGCGAGTTAGACCATGCAAATCTATAGCTCCGAGCAGTTCGTCACATATGAGCAGGAAGACGT

Reverse complement sequence

ACGTCTTCCTGCTCATATGTGACGAACTGCTCGGAGCTATAGATTTGCATGGTCTAACTCGCCAATGTCACCTGGTGACTGCTCGCCAAGTTCAGAAGTG[A/G]
GGCACCATGATGCCAACATTCTCCTTATCTGTTGTTAGACTACGTGAATCATTGTATTAACTATCACATTAGAGACGATAATTATTGGTGCCAAGAGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 34.60% 0.00% 0.32% NA
All Indica  2759 97.40% 2.30% 0.00% 0.29% NA
All Japonica  1512 0.50% 99.30% 0.00% 0.20% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 97.10% 2.40% 0.00% 0.50% NA
Indica II  465 95.70% 4.10% 0.00% 0.22% NA
Indica III  913 99.00% 0.70% 0.00% 0.33% NA
Indica Intermediate  786 96.70% 3.20% 0.00% 0.13% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 0.00% 99.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 48.90% 46.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0919119587 T -> DEL N N silent_mutation Average:84.153; most accessible tissue: Minghui63 flower, score: 91.761 N N N N
vg0919119587 T -> C LOC_Os09g32030.1 3_prime_UTR_variant ; 176.0bp to feature; MODIFIER silent_mutation Average:84.153; most accessible tissue: Minghui63 flower, score: 91.761 N N N N
vg0919119587 T -> C LOC_Os09g32020.1 upstream_gene_variant ; 1570.0bp to feature; MODIFIER silent_mutation Average:84.153; most accessible tissue: Minghui63 flower, score: 91.761 N N N N
vg0919119587 T -> C LOC_Os09g32025.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:84.153; most accessible tissue: Minghui63 flower, score: 91.761 N N N N
vg0919119587 T -> C LOC_Os09g32040.1 downstream_gene_variant ; 2239.0bp to feature; MODIFIER silent_mutation Average:84.153; most accessible tissue: Minghui63 flower, score: 91.761 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0919119587 T C 0.06 0.05 0.02 0.05 0.09 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0919119587 NA 2.37E-104 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 3.29E-101 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 8.62E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 4.29E-23 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 2.73E-09 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 1.52E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 2.47E-28 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 4.80E-24 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 1.86E-09 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 1.75E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 1.04E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 3.00E-68 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 1.03E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 3.77E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 4.41E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 2.11E-49 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 3.49E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 3.02E-26 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0919119587 NA 1.98E-10 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251