Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918950681:

Variant ID: vg0918950681 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18950681
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGTGCGAGAGGTCGACGGTGTCCACGTCGCCGTAGCAGCGCGGTATCTCGCCGGTGAGCTGGTTGTGGGAGAGGATCAAGAACCTGAAGCTGCCGTG[C/T]
ACCAGCCCCGGCGGGATGGCGCCGGTGAGGAAGTTGCCGCTGAGGTCGAGGTACCGGAGGTTGGGGTGGTCGCCGGCGAGGGACGGCGGGATCGGCCCGG

Reverse complement sequence

CCGGGCCGATCCCGCCGTCCCTCGCCGGCGACCACCCCAACCTCCGGTACCTCGACCTCAGCGGCAACTTCCTCACCGGCGCCATCCCGCCGGGGCTGGT[G/A]
CACGGCAGCTTCAGGTTCTTGATCCTCTCCCACAACCAGCTCACCGGCGAGATACCGCGCTGCTACGGCGACGTGGACACCGTCGACCTCTCGCACAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.10% 0.08% 0.28% NA
All Indica  2759 94.60% 4.90% 0.11% 0.40% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.07% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 97.10% 2.40% 0.17% 0.34% NA
Indica II  465 92.00% 7.50% 0.00% 0.43% NA
Indica III  913 98.00% 1.60% 0.00% 0.33% NA
Indica Intermediate  786 90.30% 8.90% 0.25% 0.51% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 30.00% 67.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918950681 C -> DEL LOC_Os09g31450.1 N frameshift_variant Average:83.838; most accessible tissue: Zhenshan97 panicle, score: 93.244 N N N N
vg0918950681 C -> T LOC_Os09g31450.1 synonymous_variant ; p.Val199Val; LOW synonymous_codon Average:83.838; most accessible tissue: Zhenshan97 panicle, score: 93.244 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0918950681 C T -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918950681 NA 1.35E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 1.29E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 7.72E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 1.30E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 1.20E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 2.45E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 3.87E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 1.05E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 2.21E-08 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 2.06E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 2.83E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918950681 NA 1.01E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251