\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918880163:

Variant ID: vg0918880163 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18880163
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AAACATAATTAAAAAAAACCACCTGCGCCGATAAACAATGATCATTGAGTTGTCTGGCTTAACAAAAATATATAAAGAGACAAGATAGAATCCTAAAGTC[C/T]
TACTAGCAAACTAACCTGAATATATTGCATGTTAAAATTCAAATCACATTTATATTTAACAGTACGTTTGTTGAAATTGGTTCAATTCTCGTTGAATTCC

Reverse complement sequence

GGAATTCAACGAGAATTGAACCAATTTCAACAAACGTACTGTTAAATATAAATGTGATTTGAATTTTAACATGCAATATATTCAGGTTAGTTTGCTAGTA[G/A]
GACTTTAGGATTCTATCTTGTCTCTTTATATATTTTTGTTAAGCCAGACAACTCAATGATCATTGTTTATCGGCGCAGGTGGTTTTTTTTAATTATGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 7.70% 0.04% 0.00% NA
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 93.10% 6.90% 0.00% 0.00% NA
Aus  269 49.40% 50.20% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 92.80% 7.20% 0.00% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918880163 C -> T LOC_Os09g31390.1 upstream_gene_variant ; 2590.0bp to feature; MODIFIER silent_mutation Average:65.688; most accessible tissue: Minghui63 root, score: 77.565 N N N N
vg0918880163 C -> T LOC_Os09g31390.2 upstream_gene_variant ; 2590.0bp to feature; MODIFIER silent_mutation Average:65.688; most accessible tissue: Minghui63 root, score: 77.565 N N N N
vg0918880163 C -> T LOC_Os09g31400.1 downstream_gene_variant ; 2382.0bp to feature; MODIFIER silent_mutation Average:65.688; most accessible tissue: Minghui63 root, score: 77.565 N N N N
vg0918880163 C -> T LOC_Os09g31390-LOC_Os09g31400 intergenic_region ; MODIFIER silent_mutation Average:65.688; most accessible tissue: Minghui63 root, score: 77.565 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918880163 8.52E-06 NA mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 NA 5.93E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 NA 3.97E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 1.42E-06 4.43E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 1.97E-06 5.14E-07 mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 NA 1.41E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 9.57E-06 NA mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 5.29E-06 NA mr1591_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 3.89E-06 NA mr1594_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 NA 1.82E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 4.22E-06 3.34E-08 mr1729_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 NA 7.70E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 NA 2.32E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918880163 7.06E-06 NA mr1790_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251