Variant ID: vg0918112967 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 18112967 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.34, others allele: 0.00, population size: 191. )
AGCTCAGCACCTATATTAATATAAATTCCTTTCTGTGTGGTAAAATAGTTTAACTCTTTGTTCGAATTTCAAACCCTTTGATGGTTTTTAGGTAACAAAG[C/T]
GAATACATAAGATCTTTGAAAAAGACCAAGTTGGTACATACTTCCTCCGTTTCACAATGTAAGACTTTCTAGCATTGTGCATATTCATTTAGATGTTAAT
ATTAACATCTAAATGAATATGCACAATGCTAGAAAGTCTTACATTGTGAAACGGAGGAAGTATGTACCAACTTGGTCTTTTTCAAAGATCTTATGTATTC[G/A]
CTTTGTTACCTAAAAACCATCAAAGGGTTTGAAATTCGAACAAAGAGTTAAACTATTTTACCACACAGAAAGGAATTTATATTAATATAGGTGCTGAGCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.00% | 36.00% | 0.04% | 0.00% | NA |
All Indica | 2759 | 96.00% | 4.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 97.90% | 2.00% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0918112967 | C -> T | LOC_Os09g29800.1 | stop_gained ; p.Arg51*; HIGH | stop_gained | Average:29.367; most accessible tissue: Callus, score: 67.601 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0918112967 | NA | 8.22E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 1.17E-07 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 5.98E-07 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 2.37E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 2.09E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 1.07E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 4.47E-10 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 5.27E-07 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 8.58E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918112967 | NA | 7.21E-20 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |