Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918112664:

Variant ID: vg0918112664 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 18112664
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, C: 0.33, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

AACAGAGTTCTGTAAAAAAAAACGGAGTTGCAAAATATATTCTTCTATGAAAAATTGAAGGACTAGCATGCATCTTTGCTTGCAGATATCATCTGTTCAT[C/A]
ACTGCATACGTTAAAGTTTCTGCTACAATTATTGTTGATTACTTATCATGTACCACTTTACTACTGTTTTCCAGAATAGTATGTGAGAAAATGAAAAATA

Reverse complement sequence

TATTTTTCATTTTCTCACATACTATTCTGGAAAACAGTAGTAAAGTGGTACATGATAAGTAATCAACAATAATTGTAGCAGAAACTTTAACGTATGCAGT[G/T]
ATGAACAGATGATATCTGCAAGCAAAGATGCATGCTAGTCCTTCAATTTTTCATAGAAGAATATATTTTGCAACTCCGTTTTTTTTTACAGAACTCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	36.00%	0.04%	0.00%	NA
All Indica	2759	95.90%	4.00%	0.07%	0.00%	NA
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	92.80%	7.10%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	97.80%	2.10%	0.11%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0918112664	C -> A	LOC_Os09g29790.1	upstream_gene_variant ; 3351.0bp to feature; MODIFIER	silent_mutation	Average:26.953; most accessible tissue: Callus, score: 58.491	N	N	N	N
vg0918112664	C -> A	LOC_Os09g29810.1	upstream_gene_variant ; 2461.0bp to feature; MODIFIER	silent_mutation	Average:26.953; most accessible tissue: Callus, score: 58.491	N	N	N	N
vg0918112664	C -> A	LOC_Os09g29800.1	intron_variant ; MODIFIER	silent_mutation	Average:26.953; most accessible tissue: Callus, score: 58.491	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0918112664	NA	1.01E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	3.52E-07	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	6.54E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	2.39E-06	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	7.58E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	6.20E-07	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	6.04E-10	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112664	NA	5.05E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251