Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0918112508:

Variant ID: vg0918112508 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 18112508
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, T: 0.25, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAACCCACCCTTGAGGAGTTGATTTGCATGATGTTACTATGTAAATTGCACCATGAACTGTTTGGCTGCCAATAAAGGTTAACACATTTTTTTTTTCG[A/T]
ATAGAGAGATCAAAGAAGGCTCAACAAATCTAGTGCTTTTAAAATAGATTGGGAAAACAGAGTTCTGTAAAAAAAAACGGAGTTGCAAAATATATTCTTC

Reverse complement sequence

GAAGAATATATTTTGCAACTCCGTTTTTTTTTACAGAACTCTGTTTTCCCAATCTATTTTAAAAGCACTAGATTTGTTGAGCCTTCTTTGATCTCTCTAT[T/A]
CGAAAAAAAAAATGTGTTAACCTTTATTGGCAGCCAAACAGTTCATGGTGCAATTTACATAGTAACATCATGCAAATCAACTCCTCAAGGGTGGGTTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 36.10% 0.04% 0.00% NA
All Indica  2759 95.90% 4.10% 0.04% 0.00% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 97.80% 2.10% 0.11% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0918112508 A -> T LOC_Os09g29790.1 upstream_gene_variant ; 3195.0bp to feature; MODIFIER silent_mutation Average:34.97; most accessible tissue: Callus, score: 80.523 N N N N
vg0918112508 A -> T LOC_Os09g29810.1 upstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:34.97; most accessible tissue: Callus, score: 80.523 N N N N
vg0918112508 A -> T LOC_Os09g29800.1 intron_variant ; MODIFIER silent_mutation Average:34.97; most accessible tissue: Callus, score: 80.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0918112508 NA 7.31E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 3.31E-06 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 3.87E-08 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 5.15E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 1.71E-07 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 7.31E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 2.52E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 1.75E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 1.63E-07 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 1.20E-10 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 1.31E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0918112508 NA 2.18E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251