Variant ID: vg0918111646 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 18111646 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGCTCTCGGTTATACGCGGTCACACTGAGCTCGTGTTAGCCTCGCGCAGGAAGGGGGAGACGCCGCGGCCGCGGGGGCTGCTGCTGCCGTGCAGCAGCAG[G/C]
AGGAGGAGGAGGTGGAGGCGAAGCCCCAGTTGCTGCGTGAAGACGACTCGTAATTCGCGATCTCCCTCTGTTACTATGCTCCTTGTTTTACTGCAATGCG
CGCATTGCAGTAAAACAAGGAGCATAGTAACAGAGGGAGATCGCGAATTACGAGTCGTCTTCACGCAGCAACTGGGGCTTCGCCTCCACCTCCTCCTCCT[C/G]
CTGCTGCTGCACGGCAGCAGCAGCCCCCGCGGCCGCGGCGTCTCCCCCTTCCTGCGCGAGGCTAACACGAGCTCAGTGTGACCGCGTATAACCGAGAGCA
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.70% | 3.00% | 0.32% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.80% | 9.20% | 0.99% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 72.20% | 25.20% | 2.58% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0918111646 | G -> C | LOC_Os09g29790.1 | upstream_gene_variant ; 2333.0bp to feature; MODIFIER | silent_mutation | Average:87.418; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
vg0918111646 | G -> C | LOC_Os09g29810.1 | upstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:87.418; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
vg0918111646 | G -> C | LOC_Os09g29800.1 | intron_variant ; MODIFIER | silent_mutation | Average:87.418; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0918111646 | NA | 6.67E-12 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918111646 | NA | 1.96E-07 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918111646 | NA | 1.74E-09 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0918111646 | NA | 1.74E-09 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |