| Variant ID: vg0918111643 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 18111643 |
| Reference Allele: CAGG | Alternative Allele: GAGG,C |
| Primary Allele: GAGG | Secondary Allele: CAGG |
Inferred Ancestral Allele: Not determined.
TTCTGCTCTCGGTTATACGCGGTCACACTGAGCTCGTGTTAGCCTCGCGCAGGAAGGGGGAGACGCCGCGGCCGCGGGGGCTGCTGCTGCCGTGCAGCAG[CAGG/GAGG,C]
AGGAGGAGGAGGTGGAGGCGAAGCCCCAGTTGCTGCGTGAAGACGACTCGTAATTCGCGATCTCCCTCTGTTACTATGCTCCTTGTTTTACTGCAATGCG
CGCATTGCAGTAAAACAAGGAGCATAGTAACAGAGGGAGATCGCGAATTACGAGTCGTCTTCACGCAGCAACTGGGGCTTCGCCTCCACCTCCTCCTCCT[CCTG/CCTC,G]
CTGCTGCACGGCAGCAGCAGCCCCCGCGGCCGCGGCGTCTCCCCCTTCCTGCGCGAGGCTAACACGAGCTCAGTGTGACCGCGTATAACCGAGAGCAGAA
| Populations | Population Size | Frequency of GAGG(primary allele) | Frequency of CAGG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 36.60% | 0.19% | 0.00% | C: 0.08% |
| All Indica | 2759 | 95.90% | 4.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 0.40% | 99.00% | 0.33% | 0.00% | C: 0.26% |
| Aus | 269 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.00% | 0.00% | C: 0.13% |
| Tropical Japonica | 504 | 0.60% | 97.80% | 0.99% | 0.00% | C: 0.60% |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0918111643 | CAGG -> GAGG | LOC_Os09g29790.1 | upstream_gene_variant ; 2330.0bp to feature; MODIFIER | silent_mutation | Average:87.449; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
| vg0918111643 | CAGG -> GAGG | LOC_Os09g29810.1 | upstream_gene_variant ; 3482.0bp to feature; MODIFIER | silent_mutation | Average:87.449; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
| vg0918111643 | CAGG -> GAGG | LOC_Os09g29800.1 | intron_variant ; MODIFIER | silent_mutation | Average:87.449; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
| vg0918111643 | CAGG -> C | LOC_Os09g29790.1 | upstream_gene_variant ; 2331.0bp to feature; MODIFIER | silent_mutation | Average:87.449; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
| vg0918111643 | CAGG -> C | LOC_Os09g29810.1 | upstream_gene_variant ; 3481.0bp to feature; MODIFIER | silent_mutation | Average:87.449; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
| vg0918111643 | CAGG -> C | LOC_Os09g29800.1 | intron_variant ; MODIFIER | silent_mutation | Average:87.449; most accessible tissue: Zhenshan97 flower, score: 92.326 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0918111643 | NA | 3.31E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 3.87E-08 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 3.22E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 1.71E-07 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 9.60E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 6.62E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 2.52E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 1.63E-07 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 1.20E-10 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 1.31E-07 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0918111643 | NA | 1.30E-18 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |