Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0915897224:

Variant ID: vg0915897224 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 15897224
Reference Allele: CGTAlternative Allele: TGT,C
Primary Allele: CGTSecondary Allele: TGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTCGTAGCGATTCCGGCCGCGTCCGGCGAGGTTGAGCCACTTCCCGACCATGAGGTCCTCGGGCCCCTCCGTGTCGTTGCGCGCGAGGATCTCCTCCGC[CGT/TGT,C]
GGACACCCACGTCGCGACGTCCCACGACACGACGTACCCCATGCCGTGCATGAACGGCATCGGCTGGCCGCCCATGGCGTAGCCGTAGCCGAGGTAGACG

Reverse complement sequence

CGTCTACCTCGGCTACGGCTACGCCATGGGCGGCCAGCCGATGCCGTTCATGCACGGCATGGGGTACGTCGTGTCGTGGGACGTCGCGACGTGGGTGTCC[ACG/ACA,G]
GCGGAGGAGATCCTCGCGCGCAACGACACGGAGGGGCCCGAGGACCTCATGGTCGGGAAGTGGCTCAACCTCGCCGGACGCGGCCGGAATCGCTACGACC

Allele Frequencies:

Populations Population SizeFrequency of CGT(primary allele) Frequency of TGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 44.70% 0.30% 0.00% NA
All Indica  2759 26.90% 72.80% 0.33% 0.00% NA
All Japonica  1512 99.10% 0.70% 0.26% 0.00% NA
Aus  269 73.20% 26.40% 0.37% 0.00% NA
Indica I  595 10.80% 88.70% 0.50% 0.00% NA
Indica II  465 57.00% 43.00% 0.00% 0.00% NA
Indica III  913 18.10% 81.90% 0.00% 0.00% NA
Indica Intermediate  786 31.60% 67.70% 0.76% 0.00% NA
Temperate Japonica  767 99.20% 0.40% 0.39% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0915897224 CGT -> TGT LOC_Os09g26310.1 synonymous_variant ; p.Thr229Thr; LOW synonymous_codon Average:87.368; most accessible tissue: Zhenshan97 flower, score: 95.746 N N N N
vg0915897224 CGT -> C LOC_Os09g26310.1 frameshift_variant ; p.Thr229fs; HIGH N Average:87.368; most accessible tissue: Zhenshan97 flower, score: 95.746 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0915897224 CGT C -0.28 -0.02 0.1 0.02 0.0 0.0
vg0915897224 CGT TGT 0.03 0.02 0.01 0.02 0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0915897224 NA 7.81E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915897224 NA 8.62E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0915897224 NA 1.54E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251