Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910413881:

Variant ID: vg0910413881 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10413881
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGACAATTCACTCGAGACAATAAATGTTCTATTGAGTTTGATGAGTTTGGTTTTTCTGTTAAGGACCTTCGGACCCGGCGCGTGATTCTTCGCTGCAA[T/C]
AGTCGCGGTGATCTCTACACTTCACCTACTGCCGTCCCTAGCATTGCTGCTCACAGCTTCCTTGCCGAATCCTCTACATTGTGGCATCGTCGACTTGGTC

Reverse complement sequence

GACCAAGTCGACGATGCCACAATGTAGAGGATTCGGCAAGGAAGCTGTGAGCAGCAATGCTAGGGACGGCAGTAGGTGAAGTGTAGAGATCACCGCGACT[A/G]
TTGCAGCGAAGAATCACGCGCCGGGTCCGAAGGTCCTTAACAGAAAAACCAAACTCATCAAACTCAATAGAACATTTATTGTCTCGAGTGAATTGTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	18.30%	4.38%	21.39%	NA
All Indica	2759	64.40%	0.80%	6.23%	28.60%	NA
All Japonica	1512	38.60%	53.00%	0.86%	7.54%	NA
Aus	269	56.90%	3.00%	7.43%	32.71%	NA
Indica I	595	54.30%	1.20%	11.09%	33.45%	NA
Indica II	465	72.90%	0.60%	6.67%	19.78%	NA
Indica III	913	65.00%	0.10%	4.27%	30.67%	NA
Indica Intermediate	786	66.40%	1.30%	4.58%	27.74%	NA
Temperate Japonica	767	62.20%	36.50%	0.26%	1.04%	NA
Tropical Japonica	504	7.50%	74.00%	1.98%	16.47%	NA
Japonica Intermediate	241	28.60%	61.40%	0.41%	9.54%	NA
VI/Aromatic	96	82.30%	10.40%	0.00%	7.29%	NA
Intermediate	90	55.60%	27.80%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910413881	T -> DEL	N	N	silent_mutation	Average:32.383; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg0910413881	T -> C	LOC_Os09g17010.1	downstream_gene_variant ; 3178.0bp to feature; MODIFIER	silent_mutation	Average:32.383; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg0910413881	T -> C	LOC_Os09g17020.1	intron_variant ; MODIFIER	silent_mutation	Average:32.383; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910413881	NA	2.28E-17	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.20E-13	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.25E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	7.43E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	9.26E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.06E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	3.84E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.25E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	3.28E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	3.50E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.08E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.92E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	6.55E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.11E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	4.07E-25	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.98E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.18E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.76E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	5.36E-14	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	9.64E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	6.65E-06	1.18E-10	mr1779	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.84E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	4.89E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	1.50E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.32E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.87E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	3.12E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.90E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881	NA	2.93E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251