\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910413881:

Variant ID: vg0910413881 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10413881
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGACAATTCACTCGAGACAATAAATGTTCTATTGAGTTTGATGAGTTTGGTTTTTCTGTTAAGGACCTTCGGACCCGGCGCGTGATTCTTCGCTGCAA[T/C]
AGTCGCGGTGATCTCTACACTTCACCTACTGCCGTCCCTAGCATTGCTGCTCACAGCTTCCTTGCCGAATCCTCTACATTGTGGCATCGTCGACTTGGTC

Reverse complement sequence

GACCAAGTCGACGATGCCACAATGTAGAGGATTCGGCAAGGAAGCTGTGAGCAGCAATGCTAGGGACGGCAGTAGGTGAAGTGTAGAGATCACCGCGACT[A/G]
TTGCAGCGAAGAATCACGCGCCGGGTCCGAAGGTCCTTAACAGAAAAACCAAACTCATCAAACTCAATAGAACATTTATTGTCTCGAGTGAATTGTCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 18.30% 4.38% 21.39% NA
All Indica  2759 64.40% 0.80% 6.23% 28.60% NA
All Japonica  1512 38.60% 53.00% 0.86% 7.54% NA
Aus  269 56.90% 3.00% 7.43% 32.71% NA
Indica I  595 54.30% 1.20% 11.09% 33.45% NA
Indica II  465 72.90% 0.60% 6.67% 19.78% NA
Indica III  913 65.00% 0.10% 4.27% 30.67% NA
Indica Intermediate  786 66.40% 1.30% 4.58% 27.74% NA
Temperate Japonica  767 62.20% 36.50% 0.26% 1.04% NA
Tropical Japonica  504 7.50% 74.00% 1.98% 16.47% NA
Japonica Intermediate  241 28.60% 61.40% 0.41% 9.54% NA
VI/Aromatic  96 82.30% 10.40% 0.00% 7.29% NA
Intermediate  90 55.60% 27.80% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910413881 T -> DEL N N silent_mutation Average:32.383; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg0910413881 T -> C LOC_Os09g17010.1 downstream_gene_variant ; 3178.0bp to feature; MODIFIER silent_mutation Average:32.383; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg0910413881 T -> C LOC_Os09g17020.1 intron_variant ; MODIFIER silent_mutation Average:32.383; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910413881 NA 2.28E-17 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.20E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.25E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 7.43E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 9.26E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.06E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 3.84E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.25E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 3.28E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 3.50E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.08E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.92E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 6.55E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.11E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 4.07E-25 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.98E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.18E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.76E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 5.36E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 9.64E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 6.65E-06 1.18E-10 mr1779 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.84E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 4.89E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 1.50E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.32E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.87E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 3.12E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.90E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413881 NA 2.93E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251