RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0909829640:

Variant ID: vg0909829640 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9829640
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCGGACGTTCGGGTGTTTGGCACACGTCAAGACCACCACGCCGAATGTCAAGAAGCTCGACGACAGGAGTAAGCCCATGATCTTTGTGGGTTATGAGCC[G/A]
GGGTCGAAGGCGTATCGCTGCTACGACCCTGCCTCTCGGCGCGTGCACATCTCACGTGACGTCGCATTCGACGAAGAGGCGCAATGGAGGTGGGACGGCG

Reverse complement sequence

CGCCGTCCCACCTCCATTGCGCCTCTTCGTCGAATGCGACGTCACGTGAGATGTGCACGCGCCGAGAGGCAGGGTCGTAGCAGCGATACGCCTTCGACCC[C/T]
GGCTCATAACCCACAAAGATCATGGGCTTACTCCTGTCGTCGAGCTTCTTGACATTCGGCGTGGTGGTCTTGACGTGTGCCAAACACCCGAACGTCCGCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.30%	4.10%	0.44%	4.21%	NA
All Indica	2759	97.00%	0.40%	0.47%	2.07%	NA
All Japonica	1512	92.60%	0.00%	0.07%	7.34%	NA
Aus	269	31.20%	65.40%	2.23%	1.12%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	99.10%	0.40%	0.00%	0.43%	NA
Indica III	913	93.00%	0.50%	1.20%	5.26%	NA
Indica Intermediate	786	98.30%	0.60%	0.25%	0.76%	NA
Temperate Japonica	767	86.70%	0.00%	0.13%	13.17%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	96.30%	0.00%	0.00%	3.73%	NA
VI/Aromatic	96	68.80%	2.10%	1.04%	28.12%	NA
Intermediate	90	96.70%	2.20%	0.00%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909829640	G -> DEL	LOC_Os09g16100.1	N	frameshift_variant	Average:24.097; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg0909829640	G -> A	LOC_Os09g16100.1	synonymous_variant ; p.Pro750Pro; LOW	synonymous_codon	Average:24.097; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909829640	NA	6.21E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	2.92E-10	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	7.34E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	2.91E-24	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	4.97E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	1.33E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	1.26E-06	2.41E-08	mr1049_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	1.01E-06	7.99E-11	mr1344_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	2.79E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640	NA	1.06E-07	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 16 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0909829640:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact