\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907175535:

Variant ID: vg0907175535 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7175535
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.39, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAATAGAATTTTCTAGTGTTTTGTATATGAGCGTCTTCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTT[A/G]
TCGTCGGAGAATCATTCTCGAAAGATAAGGCTCTTAGACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAAC

Reverse complement sequence

GTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTCTAAGAGCCTTATCTTTCGAGAATGATTCTCCGACGA[T/C]
AAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGAAGACGCTCATATACAAAACACTAGAAAATTCTATTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 31.10% 9.46% 23.04% NA
All Indica  2759 2.70% 44.80% 14.14% 38.35% NA
All Japonica  1512 98.90% 0.70% 0.07% 0.26% NA
Aus  269 12.30% 62.80% 18.22% 6.69% NA
Indica I  595 1.70% 37.50% 9.41% 51.43% NA
Indica II  465 2.40% 33.50% 14.84% 49.25% NA
Indica III  913 1.30% 56.40% 17.63% 24.64% NA
Indica Intermediate  786 5.20% 43.60% 13.23% 37.91% NA
Temperate Japonica  767 99.50% 0.30% 0.00% 0.26% NA
Tropical Japonica  504 98.40% 1.20% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 61.50% 35.40% 3.12% 0.00% NA
Intermediate  90 62.20% 23.30% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907175535 A -> G LOC_Os09g12530.1 upstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175535 A -> G LOC_Os09g12500.1 downstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175535 A -> G LOC_Os09g12510.1 downstream_gene_variant ; 1942.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175535 A -> G LOC_Os09g12520.1 downstream_gene_variant ; 973.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175535 A -> G LOC_Os09g12500.2 downstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175535 A -> G LOC_Os09g12510-LOC_Os09g12520 intergenic_region ; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175535 A -> DEL N N silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907175535 NA 2.64E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 4.33E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 5.83E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 4.25E-06 3.14E-08 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 8.23E-06 8.23E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 3.55E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 8.74E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 2.12E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 7.02E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 3.10E-06 NA mr1550_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 5.84E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 1.28E-06 9.47E-24 mr1637_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 1.63E-06 1.21E-06 mr1637_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 6.07E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 2.12E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 7.10E-07 5.60E-09 mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 9.93E-07 6.42E-06 mr1754_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 7.37E-06 NA mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 7.68E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 5.24E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 4.07E-07 7.46E-11 mr1819_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 7.42E-07 7.42E-07 mr1819_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 NA 5.89E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 2.34E-08 4.76E-32 mr1891_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 1.21E-07 1.21E-07 mr1891_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 3.08E-06 2.90E-06 mr1965_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 4.55E-07 4.76E-09 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175535 3.07E-07 3.07E-07 mr1982_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251