\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905354568:

Variant ID: vg0905354568 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5354568
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCTCAAGGTGTTTCCTTGATGTACAAGTTGAGAAACAAACCCGAGATACAAGTAAGATATTCTATCTATATTCGGTATCCTATATTCAGCCCAAATAT[T/C]
GTCGCCGTGTAGATATGGGATATCCATAATCTCCACAGTAGCCCCCGAGACCTTTGCAGTCATCCATCATAGCCTCCTCAAAGATAATAATCCGAGTGCT

Reverse complement sequence

AGCACTCGGATTATTATCTTTGAGGAGGCTATGATGGATGACTGCAAAGGTCTCGGGGGCTACTGTGGAGATTATGGATATCCCATATCTACACGGCGAC[A/G]
ATATTTGGGCTGAATATAGGATACCGAATATAGATAGAATATCTTACTTGTATCTCGGGTTTGTTTCTCAACTTGTACATCAAGGAAACACCTTGAGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 0.20% 3.11% 57.43% NA
All Indica  2759 7.20% 0.20% 3.73% 88.80% NA
All Japonica  1512 95.00% 0.20% 0.79% 4.03% NA
Aus  269 31.20% 0.00% 9.29% 59.48% NA
Indica I  595 7.70% 0.30% 3.87% 88.07% NA
Indica II  465 7.70% 0.20% 3.87% 88.17% NA
Indica III  913 5.00% 0.20% 3.61% 91.13% NA
Indica Intermediate  786 9.20% 0.10% 3.69% 87.02% NA
Temperate Japonica  767 95.30% 0.00% 0.91% 3.78% NA
Tropical Japonica  504 96.40% 0.40% 0.00% 3.17% NA
Japonica Intermediate  241 90.90% 0.40% 2.07% 6.64% NA
VI/Aromatic  96 82.30% 0.00% 2.08% 15.62% NA
Intermediate  90 62.20% 1.10% 5.56% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905354568 T -> DEL N N silent_mutation Average:11.847; most accessible tissue: Callus, score: 31.592 N N N N
vg0905354568 T -> C LOC_Os09g09850.1 upstream_gene_variant ; 2653.0bp to feature; MODIFIER silent_mutation Average:11.847; most accessible tissue: Callus, score: 31.592 N N N N
vg0905354568 T -> C LOC_Os09g09860.1 upstream_gene_variant ; 1009.0bp to feature; MODIFIER silent_mutation Average:11.847; most accessible tissue: Callus, score: 31.592 N N N N
vg0905354568 T -> C LOC_Os09g09870.1 downstream_gene_variant ; 4285.0bp to feature; MODIFIER silent_mutation Average:11.847; most accessible tissue: Callus, score: 31.592 N N N N
vg0905354568 T -> C LOC_Os09g09850-LOC_Os09g09860 intergenic_region ; MODIFIER silent_mutation Average:11.847; most accessible tissue: Callus, score: 31.592 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905354568 NA 8.27E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 1.63E-06 NA mr1097_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 4.80E-06 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 7.48E-06 5.46E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 9.51E-06 NA mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 3.04E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 7.69E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 4.43E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 5.93E-06 mr1306_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 4.34E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 2.76E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 2.58E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 1.37E-06 1.37E-06 mr1605_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 8.27E-06 NA mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 7.40E-06 7.38E-06 mr1752_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 1.09E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 6.71E-07 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 4.02E-08 NA mr1874_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 2.02E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 NA 1.25E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905354568 3.69E-07 3.67E-07 mr1953_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251