Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0903408056:

Variant ID: vg0903408056 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 3408056
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGAAACCTATACGATTGGATTGCCCGAAAAAAATGATGCGATATGCGGTGCGCTCTGACCCCCGACCCGAGTAAGAATAGGATTGGATTGCCATGGTC[A/G]
ATTTGGAGACGACCAAGCAAAGCAAAACCACTTTTCATGTACTCTGTCTGCCGTACCATACCATACGGCGAGAAATCCGAGATTTTGCCATTGCCATCGC

Reverse complement sequence

GCGATGGCAATGGCAAAATCTCGGATTTCTCGCCGTATGGTATGGTACGGCAGACAGAGTACATGAAAAGTGGTTTTGCTTTGCTTGGTCGTCTCCAAAT[T/C]
GACCATGGCAATCCAATCCTATTCTTACTCGGGTCGGGGGTCAGAGCGCACCGCATATCGCATCATTTTTTTCGGGCAATCCAATCGTATAGGTTTCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.60% 0.00% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 36.70% 63.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0903408056 A -> G LOC_Os09g07020.1 5_prime_UTR_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:92.102; most accessible tissue: Zhenshan97 young leaf, score: 95.964 N N N N
vg0903408056 A -> G LOC_Os09g07020.2 5_prime_UTR_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:92.102; most accessible tissue: Zhenshan97 young leaf, score: 95.964 N N N N
vg0903408056 A -> G LOC_Os09g07010.1 upstream_gene_variant ; 4947.0bp to feature; MODIFIER silent_mutation Average:92.102; most accessible tissue: Zhenshan97 young leaf, score: 95.964 N N N N
vg0903408056 A -> G LOC_Os09g07040.1 upstream_gene_variant ; 4170.0bp to feature; MODIFIER silent_mutation Average:92.102; most accessible tissue: Zhenshan97 young leaf, score: 95.964 N N N N
vg0903408056 A -> G LOC_Os09g07030.1 downstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:92.102; most accessible tissue: Zhenshan97 young leaf, score: 95.964 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0903408056 A G -0.08 -0.08 -0.06 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0903408056 NA 4.06E-37 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903408056 NA 2.28E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0903408056 NA 5.80E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 2.84E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 6.56E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 8.27E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 5.20E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 9.90E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 1.19E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 4.48E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 1.10E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 2.73E-09 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 3.29E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 2.37E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 1.03E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0903408056 NA 5.39E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251