\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901385906:

Variant ID: vg0901385906 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1385906
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGTGTCGGCGGGGAAGTTCTAAGGATTCATGGTGCATGAGAGAGGAGTTGAGATTGGTCCTAAGAAGATAGAAAAGATTCGTGATTTCAAAGCGCCG[G/A]
CATGCAAGAAGGAAGTACAAAAGTTGCTAGGTAAGGTGAATTATTTGAGAAGGTTTATTTCTAACCTAGCGGGTAAATCGATACTTTTGTTCCTATACTT

Reverse complement sequence

AAGTATAGGAACAAAAGTATCGATTTACCCGCTAGGTTAGAAATAAACCTTCTCAAATAATTCACCTTACCTAGCAACTTTTGTACTTCCTTCTTGCATG[C/T]
CGGCGCTTTGAAATCACGAATCTTTTCTATCTTCTTAGGACCAATCTCAACTCCTCTCTCATGCACCATGAATCCTTAGAACTTCCCCGCCGACACACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 22.30% 3.36% 10.01% NA
All Indica  2759 96.70% 2.00% 0.54% 0.80% NA
All Japonica  1512 2.20% 64.60% 6.35% 26.79% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 94.30% 4.50% 0.17% 1.01% NA
Indica II  465 98.50% 1.30% 0.00% 0.22% NA
Indica III  913 98.90% 0.20% 0.33% 0.55% NA
Indica Intermediate  786 94.80% 2.50% 1.40% 1.27% NA
Temperate Japonica  767 0.50% 97.10% 0.00% 2.35% NA
Tropical Japonica  504 4.20% 22.00% 14.68% 59.13% NA
Japonica Intermediate  241 3.70% 50.20% 9.13% 36.93% NA
VI/Aromatic  96 22.90% 1.00% 34.38% 41.67% NA
Intermediate  90 55.60% 21.10% 16.67% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901385906 G -> DEL N N silent_mutation Average:32.978; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0901385906 G -> A LOC_Os09g02950.1 intron_variant ; MODIFIER silent_mutation Average:32.978; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901385906 NA 7.55E-37 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906 NA 2.31E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906 5.12E-08 8.62E-57 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906 8.14E-08 1.54E-17 Grain_width Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901385906 NA 1.21E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 8.96E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 8.73E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 1.19E-35 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 7.11E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 8.37E-09 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 5.50E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 3.94E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 1.22E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 5.28E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 5.18E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 1.85E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 1.26E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 2.14E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901385906 NA 3.90E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251