Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0828199395:

Variant ID: vg0828199395 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28199395
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTATTTTTTTAATTCTGAATTTTTATTATTTCTAATTGTATTTTGTTGACGAAAAAAATCGAACACACCGGCTTGGGAGATCTGCTTAGCTCCTGTGCA[G/A]
GTACAAAGATTGATGAGATGCGGGCTTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATAGCAGATCAAAACAGCCGATCGGCTGACAAGCC

Reverse complement sequence

GGCTTGTCAGCCGATCGGCTGTTTTGATCTGCTATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCAAGCCCGCATCTCATCAATCTTTGTAC[C/T]
TGCACAGGAGCTAAGCAGATCTCCCAAGCCGGTGTGTTCGATTTTTTTCGTCAACAAAATACAATTAGAAATAATAAAAATTCAGAATTAAAAAAATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 6.60% 9.01% 10.69% NA
All Indica  2759 69.20% 0.10% 13.59% 17.11% NA
All Japonica  1512 83.50% 13.90% 1.79% 0.79% NA
Aus  269 88.50% 0.00% 4.83% 6.69% NA
Indica I  595 41.20% 0.00% 16.30% 42.52% NA
Indica II  465 61.70% 0.00% 21.94% 16.34% NA
Indica III  913 91.00% 0.00% 7.12% 1.86% NA
Indica Intermediate  786 69.50% 0.40% 14.12% 16.03% NA
Temperate Japonica  767 84.70% 12.40% 1.83% 1.04% NA
Tropical Japonica  504 90.10% 8.50% 0.99% 0.40% NA
Japonica Intermediate  241 66.00% 29.90% 3.32% 0.83% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 73.30% 12.20% 11.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828199395 G -> A LOC_Os08g44900.1 upstream_gene_variant ; 2265.0bp to feature; MODIFIER silent_mutation Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0828199395 G -> A LOC_Os08g44910.1 downstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0828199395 G -> A LOC_Os08g44900-LOC_Os08g44910 intergenic_region ; MODIFIER silent_mutation Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg0828199395 G -> DEL N N silent_mutation Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828199395 NA 9.02E-06 mr1748 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828199395 NA 6.67E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828199395 NA 7.35E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828199395 NA 1.15E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828199395 NA 1.01E-15 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828199395 NA 2.47E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251