\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825492911:

Variant ID: vg0825492911 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25492911
Reference Allele: GAlternative Allele: T,C
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATATTCCATGAATATAGCTGCTTGTCAGTGTCATAGGGATGCATATGGGCAATCATGCTACCACATAAAAACTCATCTCCATAGTTTGTTTTCTACA[G/T,C]
TTAACAGTATAAACAAAACAGACGAGAATTATAACAAGTGGAAAAAAAACTAAGGGCAGGAGAAAAAGACCAGTGGAAATGTTACTCTAGTTCTCTAAAA

Reverse complement sequence

TTTTAGAGAACTAGAGTAACATTTCCACTGGTCTTTTTCTCCTGCCCTTAGTTTTTTTTCCACTTGTTATAATTCTCGTCTGTTTTGTTTATACTGTTAA[C/A,G]
TGTAGAAAACAAACTATGGAGATGAGTTTTTATGTGGTAGCATGATTGCCCATATGCATCCCTATGACACTGACAAGCAGCTATATTCATGGAATATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.20% 0.57% 0.00% C: 0.04%
All Indica  2759 99.70% 0.10% 0.04% 0.00% C: 0.07%
All Japonica  1512 74.50% 24.60% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.00% 0.00% C: 0.34%
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 63.00% 35.50% 1.56% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 34.90% 0.41% 0.00% NA
VI/Aromatic  96 78.10% 8.30% 13.54% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825492911 G -> C LOC_Os08g40270.1 upstream_gene_variant ; 594.0bp to feature; MODIFIER silent_mutation Average:92.963; most accessible tissue: Zhenshan97 root, score: 98.473 N N N N
vg0825492911 G -> C LOC_Os08g40280.1 upstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:92.963; most accessible tissue: Zhenshan97 root, score: 98.473 N N N N
vg0825492911 G -> C LOC_Os08g40260-LOC_Os08g40270 intergenic_region ; MODIFIER silent_mutation Average:92.963; most accessible tissue: Zhenshan97 root, score: 98.473 N N N N
vg0825492911 G -> T LOC_Os08g40270.1 upstream_gene_variant ; 594.0bp to feature; MODIFIER silent_mutation Average:92.963; most accessible tissue: Zhenshan97 root, score: 98.473 N N N N
vg0825492911 G -> T LOC_Os08g40280.1 upstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:92.963; most accessible tissue: Zhenshan97 root, score: 98.473 N N N N
vg0825492911 G -> T LOC_Os08g40260-LOC_Os08g40270 intergenic_region ; MODIFIER silent_mutation Average:92.963; most accessible tissue: Zhenshan97 root, score: 98.473 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0825492911 G C -0.01 -0.04 -0.04 -0.01 -0.01 -0.03
vg0825492911 G T -0.01 -0.02 -0.04 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825492911 NA 8.38E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 1.42E-07 5.42E-11 mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 1.55E-08 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 4.66E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 9.34E-08 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 4.82E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 1.10E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 3.78E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 1.92E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 2.13E-06 NA mr1696 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 2.32E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 1.05E-06 mr1707 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 5.70E-06 NA mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 2.14E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825492911 NA 8.48E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251