Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825346328:

Variant ID: vg0825346328 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25346328
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATTGTAGGCTCAAGTGGCACTGAAGTGCAAATGTTGTGCTCCTGAATATAGTTTCCTCTAGCATCTGTCTATGGAACTTTTTGAAGTGAAAGGAGGA[G/T]
AATTTGTTAGACGAATGTTGTAGAAATTTGACAACCATGAATGACTTAAACACAGTTCTACCAAGTGTTCAATTGTTAACTCTGTATGTTGCGTGGAAAG

Reverse complement sequence

CTTTCCACGCAACATACAGAGTTAACAATTGAACACTTGGTAGAACTGTGTTTAAGTCATTCATGGTTGTCAAATTTCTACAACATTCGTCTAACAAATT[C/A]
TCCTCCTTTCACTTCAAAAAGTTCCATAGACAGATGCTAGAGGAAACTATATTCAGGAGCACAACATTTGCACTTCAGTGCCACTTGAGCCTACAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.60%	45.00%	0.36%	0.06%	NA
All Indica	2759	76.30%	23.40%	0.25%	0.00%	NA
All Japonica	1512	21.20%	78.10%	0.46%	0.20%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	79.50%	19.80%	0.67%	0.00%	NA
Indica II	465	90.10%	9.90%	0.00%	0.00%	NA
Indica III	913	76.10%	23.70%	0.22%	0.00%	NA
Indica Intermediate	786	66.00%	33.80%	0.13%	0.00%	NA
Temperate Japonica	767	8.50%	90.60%	0.65%	0.26%	NA
Tropical Japonica	504	39.90%	59.90%	0.00%	0.20%	NA
Japonica Intermediate	241	22.80%	76.30%	0.83%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	51.10%	45.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825346328	G -> T	LOC_Os08g40020.1	3_prime_UTR_variant ; 53.0bp to feature; MODIFIER	silent_mutation	Average:42.571; most accessible tissue: Callus, score: 60.213	N	N	N	N
vg0825346328	G -> T	LOC_Os08g40010.1	downstream_gene_variant ; 2379.0bp to feature; MODIFIER	silent_mutation	Average:42.571; most accessible tissue: Callus, score: 60.213	N	N	N	N
vg0825346328	G -> DEL	N	N	silent_mutation	Average:42.571; most accessible tissue: Callus, score: 60.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825346328	NA	4.92E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	2.39E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	2.63E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	7.02E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	3.25E-10	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	1.60E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	6.77E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	4.35E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825346328	NA	2.16E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251