Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821468535:

Variant ID: vg0821468535 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 21468535
Reference Allele: ATAlternative Allele: A
Primary Allele: ASecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTGATTCGATAGCGACGTGCATGAACTAGTATCGCTGTTTGGGTGGTGGGGGCAGTTGGCAAGAACAAATCTGTATCTCTGCCTCAAAAGCAACAGC[AT/A]
TTTTTTTTCTTTTGCACAAGTTGCAATTGTTTTTGTGATGGTCTTTGCTTACATCTGAATATTCCGTGTCTTCTCTGGGACAATCTCTGCTGCATGATTG

Reverse complement sequence

CAATCATGCAGCAGAGATTGTCCCAGAGAAGACACGGAATATTCAGATGTAAGCAAAGACCATCACAAAAACAATTGCAACTTGTGCAAAAGAAAAAAAA[AT/T]
GCTGTTGCTTTTGAGGCAGAGATACAGATTTGTTCTTGCCAACTGCCCCCACCACCCAAACAGCGATACTAGTTCATGCACGTCGCTATCGAATCAAGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 22.00% 0.11% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 35.40% 64.60% 0.07% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 3.90% 96.10% 0.00% 0.00% NA
Tropical Japonica  504 77.60% 22.20% 0.20% 0.00% NA
Japonica Intermediate  241 47.30% 52.70% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821468535 AT -> A LOC_Os08g34240.1 3_prime_UTR_variant ; 175.0bp to feature; MODIFIER silent_mutation Average:97.366; most accessible tissue: Minghui63 flower, score: 98.763 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0821468535 AT A -0.14 -0.04 0.06 0.01 -0.01 0.12